Difference between revisions of "Saccharum hybrid cultivar"

From ICG
Jump to navigation Jump to search
Line 81: Line 81:
 
</references>
 
</references>
 
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
 
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
 +
[[Category:GAPDH]] [[Category:Histone]] [[Category:Ubiquitin]]

Revision as of 09:05, 19 June 2017

Description

REFqPCR2014007-1.jpg
  • Sugarcane (Saccharum spp.) is a major crop with vegetative propagationandcapacitytoaccumulatehighlevelsofsucrose in the culms. World production of this crop in 2011 resulted in about two billion tons of raw material, which corresponded to a gross income of more than US$ 52 billion.
  • Despite the economic importance of sugarcane, the knowledge of relevant genetic mechanisms remains challenging, due to the fact that this crop presents one of the largest and most intricate genomes of the plant kingdom, with diploid numbers ranging from 100 to 130 chromosomes, indicating a high ploidy level, as well as regular aneuploidy events.
  • The use of sugarcane (Saccharum spp) as a source of sugar and ethanol has been very important to the Brazilian economy. In 2010/2011, 624 million tons of sugarcane were produced and used for the production of 33 million tons of sugar and 27.6 billion liters of ethanol (http://jornalcana.com.br/). In 2013/14, sugarcane cultivation continued to expand to about 314,000 ha, equivalent to an increase of 3.7% compared to the 2012/13 crop (CONAB, 2015; http://www.conab.gov.br). [1] [2].

Drought-Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
H1[1] Histone H1
  • Salt stress
CA116806
  • F:CGCACACGCACACTGAAAG
  • R:CGGTGGCCATGATCAAAAA
NA 60 SYBR
αTUB[1] Alpha-tubulin
  • Salt stress
CN607271
  • F:CCATTGGCAAGGAGATTGTT
  • R:TCCACCAACTGCATTGAAGA
NA 60 SYBR
GAPDH[1] glyceraldehyde 3-phosphate dehydrogenase
  • Salt stress
CA254672
  • F:GGTTCACTTGAAGGGTGGTG
  • R:TGAGGTGTACCTGTCCTCGTT
NA 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ederson Akio Kido
  • Email: ederson.kido@gmail.com
  • Institution: Federal University of Pernambuco (UFPE/CCB/Genética), 50670-420 Recife, PE, Brazil

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-06-16])


References

  1. 1.0 1.1 1.2 1.3 Silva RL, Silva MD, Ferreira Neto JR, et al. (2014) Validation of novel reference genes for reverse transcription quantitative real-time PCR in drought-stressed sugarcane. ScientificWorldJournal 2014, 357052.
  2. Maranho GB, Maranho RC, Desordi R, et al. (2016) Genetic divergence and admixture of ancestral genome groups in the sugarcane variety 'RB867515' (Saccharum spp). Genetics and molecular research : GMR 15