Difference between revisions of "Saccharum hybrid cultivar"

From ICG
Jump to navigation Jump to search
 
(12 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2014007-1.jpg|right|327px|]]
+
[[File:Saccharum hybrid cultivar.png|right|200px|link=Saccharum hybrid cultivar]]
* Sugarcane (Saccharum spp.) is a major crop with vegetative propagationandcapacitytoaccumulatehighlevelsofsucrose in the culms. World production of this crop in 2011 resulted in about two billion tons of raw material, which corresponded to a gross income of more than US$ 52 billion.  
+
* '''''Saccharum hybrid cultivar'''''  or '''''Saccharum spp.''''' is a major crop with vegetative propagation and capacity to accumulate high levels of sucrose in the culms. The use of sugarcane as a source of sugar and ethanol has been very important to the Brazilian economy. Despite the economic importance of sugarcane, the knowledge of relevant genetic mechanisms remains challenging, due to the fact that this crop presents one of the largest and most intricate genomes of the plant kingdom, with diploid numbers ranging from 100 to 130 chromosomes, indicating a high ploidy level, as well as regular aneuploidy events<ref name="ref1"/><ref name="ref2"/>.
* Despite the economic importance of sugarcane, the knowledge of relevant genetic mechanisms remains challenging, due to the fact that this crop presents one of the largest and most intricate genomes of the plant kingdom, with diploid numbers ranging from 100 to 130 chromosomes, indicating a high ploidy level, as well as regular aneuploidy events.
+
* <font color=blue>'''Common Name:'''</font> '''Sugarcane'''
* The use of sugarcane (Saccharum spp) as a source of sugar and ethanol has been very important to the Brazilian economy. In 2010/2011, 624 million tons of sugarcane were produced and used for the production of 33 million tons of sugar and 27.6 billion liters of ethanol (http://jornalcana.com.br/). In 2013/14, sugarcane cultivation continued to expand to about 314,000 ha, equivalent to an increase of 3.7% compared to the 2012/13 crop (CONAB, 2015; http://www.conab.gov.br). <ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=128810 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Drought Stress'''''==
 
=='''''Drought Stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 21: Line 21:
 
|align="center"| Histone H1
 
|align="center"| Histone H1
 
|
 
|
* Universal reference gene
+
* Root tissues
 +
* Drought-tolerant and -sensitive accessions after continuous dehydration (24 h)
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CA116806 '''CA116806''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CA116806 '''CA116806''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 33: Line 34:
 
|align="center"| Alpha-tubulin
 
|align="center"| Alpha-tubulin
 
|
 
|
* Universal reference gene
+
* Root tissues
 +
* Drought-tolerant and -sensitive accessions after continuous dehydration (24 h)
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CN607271 '''CN607271''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CN607271 '''CN607271''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 45: Line 47:
 
|align="center"| Glyceraldehyde 3-phosphate dehydrogenase
 
|align="center"| Glyceraldehyde 3-phosphate dehydrogenase
 
|
 
|
* Universal reference gene
+
* Root tissues
 +
* Drought-tolerant and -sensitive accessions after continuous dehydration (24 h)
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CA254672 '''CA254672''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CA254672 '''CA254672''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 55: Line 58:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 68: Line 72:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''7''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=13463452418301810755&as_sdt=2005&sciodt=0,5&hl=en'''9'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 79: Line 83:
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
+
 
[[Category:GAPDH]] [[Category:Histone]] [[Category:Ubiquitin]]
+
=='''Categories'''==
[[Category:Drought Treatment]] [[Category:Abiotic Stress]]
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:GAPDH]][[Category:Histone]][[Category:Tubulin]][[Category:Drought Treatment]][[Category:Abiotic Stress]]
 +
[[Category:geNorm]][[Category:NormFinder]][[Category:BestKeeper]]

Latest revision as of 07:27, 1 September 2017

Description

Saccharum hybrid cultivar.png
  • Saccharum hybrid cultivar or Saccharum spp. is a major crop with vegetative propagation and capacity to accumulate high levels of sucrose in the culms. The use of sugarcane as a source of sugar and ethanol has been very important to the Brazilian economy. Despite the economic importance of sugarcane, the knowledge of relevant genetic mechanisms remains challenging, due to the fact that this crop presents one of the largest and most intricate genomes of the plant kingdom, with diploid numbers ranging from 100 to 130 chromosomes, indicating a high ploidy level, as well as regular aneuploidy events[1][2].
  • Common Name: Sugarcane
  • NCBI Taxonomy

Drought Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
H1[1] Histone H1
  • Root tissues
  • Drought-tolerant and -sensitive accessions after continuous dehydration (24 h)
CA116806
  • F:CGCACACGCACACTGAAAG
  • R:CGGTGGCCATGATCAAAAA
NA 60 SYBR
αTUB[1] Alpha-tubulin
  • Root tissues
  • Drought-tolerant and -sensitive accessions after continuous dehydration (24 h)
CN607271
  • F:CCATTGGCAAGGAGATTGTT
  • R:TCCACCAACTGCATTGAAGA
NA 60 SYBR
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Root tissues
  • Drought-tolerant and -sensitive accessions after continuous dehydration (24 h)
CA254672
  • F:GGTTCACTTGAAGGGTGGTG
  • R:TGAGGTGTACCTGTCCTCGTT
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ederson Akio Kido
  • Email: ederson.kido@gmail.com
  • Institution: Federal University of Pernambuco (UFPE/CCB/Genética), 50670-420 Recife, PE, Brazil

Citation Statistics

Cited by 9 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Silva RL, Silva MD, Ferreira Neto JR, et al. (2014) Validation of novel reference genes for reverse transcription quantitative real-time PCR in drought-stressed sugarcane. ScientificWorldJournal 2014, 357052.
  2. Maranho GB, Maranho RC, Desordi R, et al. (2016) Genetic divergence and admixture of ancestral genome groups in the sugarcane variety 'RB867515' (Saccharum spp). Genetics and molecular research : GMR 15

Categories