Difference between revisions of "Saccharum hybrid cultivar"

Revision as of 08:33, 11 August 2017

Saccharum hybrid cultivar or Saccharum spp. is a major crop with vegetative propagation and capacity to accumulate high levels of sucrose in the culms. The use of sugarcane as a source of sugar and ethanol has been very important to the Brazilian economy. Despite the economic importance of sugarcane, the knowledge of relevant genetic mechanisms remains challenging, due to the fact that this crop presents one of the largest and most intricate genomes of the plant kingdom, with diploid numbers ranging from 100 to 130 chromosomes, indicating a high ploidy level, as well as regular aneuploidy events^[1]^[2].
Common Name: Sugarcane
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
H1^[1]	Histone H1	Root tissues Drought-tolerant and -sensitive accessions after continuous dehydration (24 h)	CA116806	F:CGCACACGCACACTGAAAG R:CGGTGGCCATGATCAAAAA	NA	60	SYBR
αTUB^[1]	Alpha-tubulin	Root tissues Drought-tolerant and -sensitive accessions after continuous dehydration (24 h)	CN607271	F:CCATTGGCAAGGAGATTGTT R:TCCACCAACTGCATTGAAGA	NA	60	SYBR
GAPDH^[1]	Glyceraldehyde 3-phosphate dehydrogenase	Root tissues Drought-tolerant and -sensitive accessions after continuous dehydration (24 h)	CA254672	F:GGTTCACTTGAAGGGTGGTG R:TGAGGTGTACCTGTCCTCGTT	NA	60	SYBR

Name: Ederson Akio Kido
Email: ederson.kido@gmail.com
Institution: Federal University of Pernambuco (UFPE/CCB/Genética), 50670-420 Recife, PE, Brazil

Cited by 9 (Based on Google Scholar [2017-08-10])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Silva RL, Silva MD, Ferreira Neto JR, et al. (2014) Validation of novel reference genes for reverse transcription quantitative real-time PCR in drought-stressed sugarcane. ScientificWorldJournal 2014, 357052.
↑ Maranho GB, Maranho RC, Desordi R, et al. (2016) Genetic divergence and admixture of ancestral genome groups in the sugarcane variety 'RB867515' (Saccharum spp). Genetics and molecular research : GMR 15

@@ Line 72: / Line 72: @@
 ===Citation Statistics===
-Cited by '''7''' (Based on Google Scholar [2017-06-16])
+Cited by '''9''' (Based on Google Scholar [2017-08-10])
 =='''References'''==