Saccharum hybrid cultivar

From ICG
Jump to navigation Jump to search

Description

REFqPCR2014007-1.jpg
  • Sugarcane (Saccharum spp.) is a major crop with vegetative propagationandcapacitytoaccumulatehighlevelsofsucrose in the culms. The use of sugarcane (Saccharum spp) as a source of sugar and ethanol has been very important to the Brazilian economy. Despite the economic importance of sugarcane, the knowledge of relevant genetic mechanisms remains challenging, due to the fact that this crop presents one of the largest and most intricate genomes of the plant kingdom, with diploid numbers ranging from 100 to 130 chromosomes, indicating a high ploidy level, as well as regular aneuploidy events. [1] [2].
  • Common Name: Sugarcane
  • NCBI Taxonomy

Drought Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
H1[1] Histone H1
  • Universal reference gene
CA116806
  • F:CGCACACGCACACTGAAAG
  • R:CGGTGGCCATGATCAAAAA
NA 60 SYBR
αTUB[1] Alpha-tubulin
  • Universal reference gene
CN607271
  • F:CCATTGGCAAGGAGATTGTT
  • R:TCCACCAACTGCATTGAAGA
NA 60 SYBR
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Universal reference gene
CA254672
  • F:GGTTCACTTGAAGGGTGGTG
  • R:TGAGGTGTACCTGTCCTCGTT
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ederson Akio Kido
  • Email: ederson.kido@gmail.com
  • Institution: Federal University of Pernambuco (UFPE/CCB/Genética), 50670-420 Recife, PE, Brazil

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Silva RL, Silva MD, Ferreira Neto JR, et al. (2014) Validation of novel reference genes for reverse transcription quantitative real-time PCR in drought-stressed sugarcane. ScientificWorldJournal 2014, 357052.
  2. Maranho GB, Maranho RC, Desordi R, et al. (2016) Genetic divergence and admixture of ancestral genome groups in the sugarcane variety 'RB867515' (Saccharum spp). Genetics and molecular research : GMR 15