Difference between revisions of "Salmo salar"

From ICG
Jump to navigation Jump to search
 
(16 intermediate revisions by 4 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:REFqPCRSalmo salar.jpg|right|227px|]]
+
[[File:Salmo salar.png|right|200px|link=Salmo salar]]
  
* Salmo salar (Salmo salar) is a menber of salmon fish family. This kind of fish is found in the North Atlantic, in the river that flow into the north Atlantic. It is also found in the North Pacific due to human introduction.
+
* '''''Salmo salar''''' is a menber of salmon fish family. This kind of fish is found in the river that flow into the north Atlantic. It is also found in the North Pacific due to human introduction. Atlantic salmon has been significantly reducing because of the recreational and commercial fishing, as well as the habitat destruction. This species is the subject of several national protection efforts.
* Atlantic salmon has been significantly reducing because of the recreational and commercial fishing, as well as the habitat destruction. The species is the subject of several national protection efforts.
+
* <font color=blue>'''Common Name:'''</font> '''Atlantic salmon'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=8030 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Tissues & Smoltification Process'''''==
 
=='''''Different Tissues & Smoltification Process'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 19: Line 20:
 
|-
 
|-
 
|align="center"| EF1AA<ref name="ref1"/>
 
|align="center"| EF1AA<ref name="ref1"/>
|align="center"| elongation factor 1A A
+
|align="center"| Elongation factor 1A A
 
|
 
|
* Univeral reference gene
+
* Gills, liver, head kidney, spleen, thymus, brain, muscle, and posterior intestine
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/11596419 '''AF321836 ''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/11596419 '''AF321836 ''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 31: Line 32:
 
|-
 
|-
 
|align="center"| EF1AB<ref name="ref1"/>
 
|align="center"| EF1AB<ref name="ref1"/>
|align="center"| elongation factor 1A B
+
|align="center"| Elongation factor 1A B
 
|
 
|
* Univeral reference gene
+
* Gills, liver, head kidney, spleen, thymus, brain, muscle, and posterior intestine
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/BG933853 '''BG933853''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nucest/BG933853 '''BG933853''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 43: Line 44:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 52: Line 53:
 
*'''Name''': Pål A Olsvik
 
*'''Name''': Pål A Olsvik
 
*'''Email''': pal.olsvik@nifes.no
 
*'''Email''': pal.olsvik@nifes.no
*'''Institute''': National Institute of Nutrition and Seafood Research, Nordnesboder,N-5020 Bergen, Norway
+
*'''Institution''': National Institute of Nutrition and Seafood Research, Nordnesboder,N-5020 Bergen, Norway
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''432''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=16759844404964101126&as_sdt=2005&sciodt=0,5&hl=en '''436'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 62: Line 63:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
[[Category:mRNA]] 
+
[[Category:mRNA]]
 
[[Category:TaqMan]]
 
[[Category:TaqMan]]
 
[[Category:EF1α]] [[Category:EF1α]]
 
[[Category:EF1α]] [[Category:EF1α]]
 
[[Category:Different Tissues]]  [[Category:Different Developmental Stages]]
 
[[Category:Different Tissues]]  [[Category:Different Developmental Stages]]
 +
[[Category:geNorm]]

Latest revision as of 04:37, 1 September 2017

Description

Salmo salar.png
  • Salmo salar is a menber of salmon fish family. This kind of fish is found in the river that flow into the north Atlantic. It is also found in the North Pacific due to human introduction. Atlantic salmon has been significantly reducing because of the recreational and commercial fishing, as well as the habitat destruction. This species is the subject of several national protection efforts.
  • Common Name: Atlantic salmon
  • NCBI Taxonomy

Different Tissues & Smoltification Process

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1AA[1] Elongation factor 1A A
  • Gills, liver, head kidney, spleen, thymus, brain, muscle, and posterior intestine
AF321836
  • F:CCCCTCCAGGACGTTTACAAA
  • R:CACACGGCCCACAGGTACA
57 60 TaqMan
EF1AB[1] Elongation factor 1A B
  • Gills, liver, head kidney, spleen, thymus, brain, muscle, and posterior intestine
BG933853
  • F:TGCCCCTCCAGGATGTCTAC
  • R:CACGGCCCACAGGTACTG
59 60 TaqMan

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pål A Olsvik
  • Email: pal.olsvik@nifes.no
  • Institution: National Institute of Nutrition and Seafood Research, Nordnesboder,N-5020 Bergen, Norway

Citation Statistics

Cited by 436 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 Olsvik P A, Lie K K, Jordal A E O, et al. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon[J]. BMC Molecular Biology, 2005, 6(1): 21.

Categories