Difference between revisions of "Salmo salar"

From ICG
Jump to navigation Jump to search
Line 2: Line 2:
 
[[File:REFqPCRSalmo salar.jpg|right|227px|]]
 
[[File:REFqPCRSalmo salar.jpg|right|227px|]]
  
* Salmo salar (Salmo salar) is a menber of salmon fish family. This kind of fish is found in the North Atlantic, in the river that flow into the north Atlantic. It is also found in the North Pacific due to human introduction.
+
* Salmo salar is a menber of salmon fish family. This kind of fish is found in the river that flow into the north Atlantic. It is also found in the North Pacific due to human introduction. Atlantic salmon has been significantly reducing because of the recreational and commercial fishing, as well as the habitat destruction. This species is the subject of several national protection efforts.
* Atlantic salmon has been significantly reducing because of the recreational and commercial fishing, as well as the habitat destruction. The species is the subject of several national protection efforts.
 
  
 
=='''''Different Tissues & Smoltification Process'''''==
 
=='''''Different Tissues & Smoltification Process'''''==

Revision as of 09:57, 22 June 2017

Description

REFqPCRSalmo salar.jpg
  • Salmo salar is a menber of salmon fish family. This kind of fish is found in the river that flow into the north Atlantic. It is also found in the North Pacific due to human introduction. Atlantic salmon has been significantly reducing because of the recreational and commercial fishing, as well as the habitat destruction. This species is the subject of several national protection efforts.

Different Tissues & Smoltification Process

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1AA[1] elongation factor 1A A
  • Univeral reference gene
AF321836
  • F:CCCCTCCAGGACGTTTACAAA
  • R:CACACGGCCCACAGGTACA
57 60 TaqMan
EF1AB[1] elongation factor 1A B
  • Univeral reference gene
BG933853
  • F:TGCCCCTCCAGGATGTCTAC
  • R:CACGGCCCACAGGTACTG
59 60 TaqMan

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pål A Olsvik
  • Email: pal.olsvik@nifes.no
  • Institute: National Institute of Nutrition and Seafood Research, Nordnesboder,N-5020 Bergen, Norway

Citation Statistics

Cited by 432 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 Olsvik P A, Lie K K, Jordal A E O, et al. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon[J]. BMC Molecular Biology, 2005, 6(1): 21.