Difference between revisions of "Salmo salar"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''''Different Tissues & Smoltification Process'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene...")
 
Line 4: Line 4:
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
! Gene symbol  
+
! Gene Symbol  
! Gene name
+
! Gene Name
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
Line 38: Line 38:
 
|}
 
|}
  
===Moleculer types===
+
===Moleculer Types===
 
* mRNA
 
* mRNA
  
Line 48: Line 48:
 
*'''Email''': pal.olsvik@nifes.no
 
*'''Email''': pal.olsvik@nifes.no
 
*'''Institute''': National Institute of Nutrition and Seafood Research, Nordnesboder,N-5020 Bergen, Norway
 
*'''Institute''': National Institute of Nutrition and Seafood Research, Nordnesboder,N-5020 Bergen, Norway
 +
===Citation Statistics===
 +
Cited by '''432''' (Based on Google Scholar [2017-06-16])
  
 
=='''References'''==
 
=='''References'''==

Revision as of 10:32, 16 June 2017

Description

Different Tissues & Smoltification Process

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
EF1AA[1] elongation factor 1A A
  • Univeral reference gene
AF321836
  • F:CCCCTCCAGGACGTTTACAAA
  • R:CACACGGCCCACAGGTACA
57 60 TaqMan
EF1AB[1] elongation factor 1A B
  • Univeral reference gene
BG933853
  • F:TGCCCCTCCAGGATGTCTAC
  • R:CACGGCCCACAGGTACTG
59 60 TaqMan

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pål A Olsvik
  • Email: pal.olsvik@nifes.no
  • Institute: National Institute of Nutrition and Seafood Research, Nordnesboder,N-5020 Bergen, Norway

Citation Statistics

Cited by 432 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 Olsvik P A, Lie K K, Jordal A E O, et al. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon[J]. BMC Molecular Biology, 2005, 6(1): 21.