Difference between revisions of "Salmo salar"

From ICG
Jump to navigation Jump to search
Line 57: Line 57:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
[[Category:Animals]]

Revision as of 10:32, 16 June 2017

Description

Different Tissues & Smoltification Process

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
EF1AA[1] elongation factor 1A A
  • Univeral reference gene
AF321836
  • F:CCCCTCCAGGACGTTTACAAA
  • R:CACACGGCCCACAGGTACA
57 60 TaqMan
EF1AB[1] elongation factor 1A B
  • Univeral reference gene
BG933853
  • F:TGCCCCTCCAGGATGTCTAC
  • R:CACGGCCCACAGGTACTG
59 60 TaqMan

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pål A Olsvik
  • Email: pal.olsvik@nifes.no
  • Institute: National Institute of Nutrition and Seafood Research, Nordnesboder,N-5020 Bergen, Norway

Citation Statistics

Cited by 432 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 Olsvik P A, Lie K K, Jordal A E O, et al. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon[J]. BMC Molecular Biology, 2005, 6(1): 21.