Difference between revisions of "Salvia miltiorrhiza"

From ICG
Jump to navigation Jump to search
Line 22: Line 22:
 
|align="center"| Cytoskeletal structural protein
 
|align="center"| Cytoskeletal structural protein
 
|
 
|
*roots, stems, leaves, sepals, petals, stamens and pistils
+
*Roots, stems, leaves, sepals, petals, stamens and pistils
 
|align="center"| NA
 
|align="center"| NA
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 34: Line 34:
 
|align="center"| Ubiquitin protein  
 
|align="center"| Ubiquitin protein  
 
|
 
|
*roots, stems, leaves, sepals, petals, stamens and pistils
+
*Roots, stems, leaves, sepals, petals, stamens and pistils
 
|align="center"| NA
 
|align="center"| NA
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|

Revision as of 02:41, 18 June 2017

Description

Salvia miltiorrhiza-1.jpg
  • Salvia miltiorrhiza, Danshen in Chinese, is a highly valued traditional Chinese medicine for the treatment of atherosclerosis-related disorders, such as cardiovascular and cerebrovascular diseases in China.
  • Salvia miltiorrhiza root has long been used in Asian countries for clinical treatment of various microcirculatory disturbance-related diseases.
  • For several decades, Salvia miltiorrhiza root has been widely used in clinics in China, Korea, Japan and other Asian countries for the treatment of various microcirculatory disturbance-related diseases, such as cardiovascular disease, cerebrovascular disease, liver dysfunction, renal deficiency and diabetic vascular complication[1] [2] .

Various Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Actin[1] Cytoskeletal structural protein
  • Roots, stems, leaves, sepals, petals, stamens and pistils
NA
  • F:AGGAACCACCGATCCAGACA
  • R:GGTGCCCTGAGGTCCTGTT
278 58 SYBR
Ubiquitin[1] Ubiquitin protein
  • Roots, stems, leaves, sepals, petals, stamens and pistils
NA
  • F:GTTGATTTTTGCTGGGAAGC
  • R:GATCTTGGCCTTCACGTTGT
146 58 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Luqi Huang
  • Email: huangluqi@263.net
  • Institution: Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, 100700 Beijing, China

Citation Statistics

Cited by 63 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Yang Y, Hou S, Cui G, et al. Characterization of reference genes for quantitative real-time PCR analysis in various tissues of Salvia miltiorrhiza[J]. Molecular biology reports, 2010, 37(1): 507-513.
  2. Han J Y, Fan J Y, Horie Y, et al. Ameliorating effects of compounds derived from Salvia miltiorrhiza root extract on microcirculatory disturbance and target organ injury by ischemia and reperfusion[J]. Pharmacology & therapeutics, 2008, 117(2): 280-295.