Difference between revisions of "Salvia miltiorrhiza"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''''Various Tissues'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name ! sty...")
 
Line 17: Line 17:
 
|
 
|
 
*roots, stems, leaves, sepals, petals, stamens and pistils
 
*roots, stems, leaves, sepals, petals, stamens and pistils
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/M36171.1 '''M36171''']
+
|align="center"| NA
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:AGGAACCACCGATCCAGACA
 
* F:AGGAACCACCGATCCAGACA
Line 29: Line 29:
 
|
 
|
 
*roots, stems, leaves, sepals, petals, stamens and pistils
 
*roots, stems, leaves, sepals, petals, stamens and pistils
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/CP002687.1 '''CP002687''']
+
|align="center"| NA
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GTTGATTTTTGCTGGGAAGC
 
* F:GTTGATTTTTGCTGGGAAGC
Line 37: Line 37:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
 +
 
===Moleculer Type===
 
===Moleculer Type===
 
* mRNA
 
* mRNA

Revision as of 13:11, 16 June 2017

Description

Various Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Actin[1] Cytoskeletal structural protein
  • roots, stems, leaves, sepals, petals, stamens and pistils
NA
  • F:AGGAACCACCGATCCAGACA
  • R:GGTGCCCTGAGGTCCTGTT
278 58 SYBR
Ubiquitin[1] Ubiquitin protein
  • roots, stems, leaves, sepals, petals, stamens and pistils
NA
  • F:GTTGATTTTTGCTGGGAAGC
  • R:GATCTTGGCCTTCACGTTGT
146 58 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Luqi Huang
  • Email: huangluqi@263.net
  • Institution: Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, 100700 Beijing, China

References

  1. 1.0 1.1 Yang Y, Hou S, Cui G, et al. Characterization of reference genes for quantitative real-time PCR analysis in various tissues of Salvia miltiorrhiza[J]. Molecular biology reports, 2010, 37(1): 507-513.