Difference between revisions of "Salvia miltiorrhiza"
Jump to navigation
Jump to search
(Created page with "=='''Description'''== =='''''Various Tissues'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name ! sty...") |
|||
| Line 17: | Line 17: | ||
| | | | ||
*roots, stems, leaves, sepals, petals, stamens and pistils | *roots, stems, leaves, sepals, petals, stamens and pistils | ||
| − | |align="center"| | + | |align="center"| NA |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:AGGAACCACCGATCCAGACA | * F:AGGAACCACCGATCCAGACA | ||
| Line 29: | Line 29: | ||
| | | | ||
*roots, stems, leaves, sepals, petals, stamens and pistils | *roots, stems, leaves, sepals, petals, stamens and pistils | ||
| − | |align="center"| | + | |align="center"| NA |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GTTGATTTTTGCTGGGAAGC | * F:GTTGATTTTTGCTGGGAAGC | ||
| Line 37: | Line 37: | ||
|align="center"| SYBR | |align="center"| SYBR | ||
|} | |} | ||
| + | |||
===Moleculer Type=== | ===Moleculer Type=== | ||
* mRNA | * mRNA | ||
Revision as of 13:11, 16 June 2017
Contents
Description
Various Tissues
Reference Genes
| Gene Symbol | Gene Name | Application Scope | Accession Number | Primer | Size [bp] | Tm [℃] | Detection |
|---|---|---|---|---|---|---|---|
| Actin[1] | Cytoskeletal structural protein |
|
NA |
|
278 | 58 | SYBR |
| Ubiquitin[1] | Ubiquitin protein |
|
NA |
|
146 | 58 | SYBR |
Moleculer Type
- mRNA
Evaluation Methods
Contact
- Name: Luqi Huang
- Email: huangluqi@263.net
- Institution: Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, 100700 Beijing, China
