Difference between revisions of "Salvia miltiorrhiza"
Jump to navigation
Jump to search
(Created page with "=='''Description'''== =='''''Various Tissues'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name ! sty...") |
|||
(21 intermediate revisions by 6 users not shown) | |||
Line 1: | Line 1: | ||
=='''Description'''== | =='''Description'''== | ||
− | ==''''' | + | [[File:Salvia miltiorrhiza.png|right|200px|link=Salvia miltiorrhiza]] |
− | === | + | *'''''Salvia miltiorrhiza''''', known as red sage, Chinese sage, tan shen, or danshen, is a perennial plant in the genus Salvia. It is highly valued for its roots in traditional Chinese medicine. Native to China and Japan, it grows at 90 to 1200 m elevation, preferring grassy places in forests, hillsides, and along stream banks. For several decades, Salvia miltiorrhiza root has been widely used in clinics in China, Korea, Japan and other Asian countries for the treatment of various microcirculatory disturbance-related diseases<ref name="ref1"/><ref name="ref2"/> . |
+ | * <font color=blue>'''Common Name:'''</font> '''Red sage''', '''Chinese sage''', '''Tan shen''', '''Danshen''' | ||
+ | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=226208 <font color=blue>'''NCBI Taxonomy'''</font>] | ||
+ | |||
+ | =='''''Different Tissues'''''== | ||
+ | ===Internal Control Genes=== | ||
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 8: | Line 13: | ||
! style="width=25% font-size:9pt "|Application Scope | ! style="width=25% font-size:9pt "|Application Scope | ||
! Accession Number | ! Accession Number | ||
− | ! | + | ! Primers (5'-3')<br>[Forward/Reverse] |
! Size [bp] | ! Size [bp] | ||
! Tm [℃] | ! Tm [℃] | ||
Line 16: | Line 21: | ||
|align="center"| Cytoskeletal structural protein | |align="center"| Cytoskeletal structural protein | ||
| | | | ||
− | * | + | *Roots, stems, leaves, sepals, petals, stamens and pistils |
− | |align="center"| | + | |align="center"| NA |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:AGGAACCACCGATCCAGACA | * F:AGGAACCACCGATCCAGACA | ||
Line 28: | Line 33: | ||
|align="center"| Ubiquitin protein | |align="center"| Ubiquitin protein | ||
| | | | ||
− | * | + | *Roots, stems, leaves, sepals, petals, stamens and pistils |
− | |align="center"| | + | |align="center"| NA |
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GTTGATTTTTGCTGGGAAGC | * F:GTTGATTTTTGCTGGGAAGC | ||
Line 37: | Line 42: | ||
|align="center"| SYBR | |align="center"| SYBR | ||
|} | |} | ||
− | === | + | |
+ | ===Molecular Types=== | ||
* mRNA | * mRNA | ||
+ | |||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
* [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
Line 45: | Line 52: | ||
*'''Email''': huangluqi@263.net | *'''Email''': huangluqi@263.net | ||
*'''Institution''': Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, 100700 Beijing, China | *'''Institution''': Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, 100700 Beijing, China | ||
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=4227671289470570013&as_sdt=2005&sciodt=0,5&hl=en'''69'''] (Based on Google Scholar [2017-09-01]) | ||
+ | |||
=='''References'''== | =='''References'''== | ||
<references> | <references> | ||
<ref name="ref1"> | <ref name="ref1"> | ||
Yang Y, Hou S, Cui G, et al. Characterization of reference genes for quantitative real-time PCR analysis in various tissues of Salvia miltiorrhiza[J]. Molecular biology reports, 2010, 37(1): 507-513. | Yang Y, Hou S, Cui G, et al. Characterization of reference genes for quantitative real-time PCR analysis in various tissues of Salvia miltiorrhiza[J]. Molecular biology reports, 2010, 37(1): 507-513. | ||
+ | </ref> | ||
+ | <ref name="ref2"> | ||
+ | Han J Y, Fan J Y, Horie Y, et al. Ameliorating effects of compounds derived from Salvia miltiorrhiza root extract on microcirculatory disturbance and target organ injury by ischemia and reperfusion[J]. Pharmacology & therapeutics, 2008, 117(2): 280-295. | ||
</ref> | </ref> | ||
</references> | </references> | ||
+ | |||
+ | =='''Categories'''== | ||
+ | [[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:ACT]] [[Category:Ubiquitin]][[Category:Different Tissues]][[Category:geNorm]] |
Latest revision as of 07:29, 1 September 2017
Contents
Description
- Salvia miltiorrhiza, known as red sage, Chinese sage, tan shen, or danshen, is a perennial plant in the genus Salvia. It is highly valued for its roots in traditional Chinese medicine. Native to China and Japan, it grows at 90 to 1200 m elevation, preferring grassy places in forests, hillsides, and along stream banks. For several decades, Salvia miltiorrhiza root has been widely used in clinics in China, Korea, Japan and other Asian countries for the treatment of various microcirculatory disturbance-related diseases[1][2] .
- Common Name: Red sage, Chinese sage, Tan shen, Danshen
- NCBI Taxonomy
Different Tissues
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
Actin[1] | Cytoskeletal structural protein |
|
NA |
|
278 | 58 | SYBR |
Ubiquitin[1] | Ubiquitin protein |
|
NA |
|
146 | 58 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
Contact
- Name: Luqi Huang
- Email: huangluqi@263.net
- Institution: Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, 100700 Beijing, China
Citation Statistics
Cited by 69 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 Yang Y, Hou S, Cui G, et al. Characterization of reference genes for quantitative real-time PCR analysis in various tissues of Salvia miltiorrhiza[J]. Molecular biology reports, 2010, 37(1): 507-513.
- ↑ Han J Y, Fan J Y, Horie Y, et al. Ameliorating effects of compounds derived from Salvia miltiorrhiza root extract on microcirculatory disturbance and target organ injury by ischemia and reperfusion[J]. Pharmacology & therapeutics, 2008, 117(2): 280-295.