Difference between revisions of "Salvia miltiorrhiza"

From ICG
Jump to navigation Jump to search
 
(14 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 +
[[File:Salvia miltiorrhiza.png|right|200px|link=Salvia miltiorrhiza]]
 +
*'''''Salvia miltiorrhiza''''', known as red sage, Chinese sage, tan shen, or danshen, is a perennial plant in the genus Salvia. It is highly valued for its roots in traditional Chinese medicine. Native to China and Japan, it grows at 90 to 1200 m elevation, preferring grassy places in forests, hillsides, and along stream banks. For several decades, Salvia miltiorrhiza root has been widely used in clinics in China, Korea, Japan and other Asian countries for the treatment of various microcirculatory disturbance-related diseases<ref name="ref1"/><ref name="ref2"/> .
 +
* <font color=blue>'''Common Name:'''</font> '''Red sage''', '''Chinese sage''', '''Tan shen''', '''Danshen'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=226208 <font color=blue>'''NCBI Taxonomy'''</font>]
  
[[File:Salvia miltiorrhiza-1.jpg|right|327px|]]
+
=='''''Different Tissues'''''==
* Salvia miltiorrhiza, Danshen in Chinese, is a highly valued traditional Chinese medicine for the treatment of atherosclerosis-related disorders, such as cardiovascular and cerebrovascular diseases in China.
+
===Internal Control Genes===
* Salvia miltiorrhiza root has long been used in Asian countries for clinical treatment of various microcirculatory disturbance-related diseases.
 
* For several decades, Salvia miltiorrhiza root has been widely used in clinics in China, Korea, Japan and other Asian countries for the treatment of various microcirculatory disturbance-related diseases, such as cardiovascular disease, cerebrovascular disease, liver dysfunction, renal deficiency and diabetic vascular complication<ref name="ref1"/> <ref name="ref2"/> .
 
 
 
=='''''Various Tissues'''''==
 
===Reference Genes===
 
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 14: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 44: Line 43:
 
|}
 
|}
  
===Moleculer Type===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 53: Line 53:
 
*'''Institution''': Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, 100700 Beijing, China
 
*'''Institution''': Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, 100700 Beijing, China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''63''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=4227671289470570013&as_sdt=2005&sciodt=0,5&hl=en'''69'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 64: Line 64:
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]] 
+
 
[[Category:ACT]] [[Category:Ubiquitin]]
+
=='''Categories'''==
 +
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:ACT]] [[Category:Ubiquitin]][[Category:Different Tissues]][[Category:geNorm]]

Latest revision as of 07:29, 1 September 2017

Description

Salvia miltiorrhiza.png
  • Salvia miltiorrhiza, known as red sage, Chinese sage, tan shen, or danshen, is a perennial plant in the genus Salvia. It is highly valued for its roots in traditional Chinese medicine. Native to China and Japan, it grows at 90 to 1200 m elevation, preferring grassy places in forests, hillsides, and along stream banks. For several decades, Salvia miltiorrhiza root has been widely used in clinics in China, Korea, Japan and other Asian countries for the treatment of various microcirculatory disturbance-related diseases[1][2] .
  • Common Name: Red sage, Chinese sage, Tan shen, Danshen
  • NCBI Taxonomy

Different Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Actin[1] Cytoskeletal structural protein
  • Roots, stems, leaves, sepals, petals, stamens and pistils
NA
  • F:AGGAACCACCGATCCAGACA
  • R:GGTGCCCTGAGGTCCTGTT
278 58 SYBR
Ubiquitin[1] Ubiquitin protein
  • Roots, stems, leaves, sepals, petals, stamens and pistils
NA
  • F:GTTGATTTTTGCTGGGAAGC
  • R:GATCTTGGCCTTCACGTTGT
146 58 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Luqi Huang
  • Email: huangluqi@263.net
  • Institution: Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, 100700 Beijing, China

Citation Statistics

Cited by 69 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Yang Y, Hou S, Cui G, et al. Characterization of reference genes for quantitative real-time PCR analysis in various tissues of Salvia miltiorrhiza[J]. Molecular biology reports, 2010, 37(1): 507-513.
  2. Han J Y, Fan J Y, Horie Y, et al. Ameliorating effects of compounds derived from Salvia miltiorrhiza root extract on microcirculatory disturbance and target organ injury by ischemia and reperfusion[J]. Pharmacology & therapeutics, 2008, 117(2): 280-295.

Categories