Salvia miltiorrhiza

From ICG
Revision as of 13:47, 16 June 2017 by ICG Expert4 (talk | contribs)
Jump to navigation Jump to search

Description

Salvia miltiorrhiza-1.jpg
  • Salvia miltiorrhiza, Danshen in Chinese, is a highly valued traditional Chinese medicine for the treatment of atherosclerosis-related disorders, such as cardiovascular and cerebrovascular diseases in China.
  • Salvia miltiorrhiza root has long been used in Asian countries for clinical treatment of various microcirculatory disturbance-related diseases.
  • For several decades, Salvia miltiorrhiza root has been widely used in clinics in China, Korea, Japan and other Asian countries for the treatment of various microcirculatory disturbance-related diseases, such as cardiovascular disease, cerebrovascular disease, liver dysfunction, renal deficiency and diabetic vascular complication[1] [2] .

Various Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Actin[1] Cytoskeletal structural protein
  • roots, stems, leaves, sepals, petals, stamens and pistils
NA
  • F:AGGAACCACCGATCCAGACA
  • R:GGTGCCCTGAGGTCCTGTT
278 58 SYBR
Ubiquitin[1] Ubiquitin protein
  • roots, stems, leaves, sepals, petals, stamens and pistils
NA
  • F:GTTGATTTTTGCTGGGAAGC
  • R:GATCTTGGCCTTCACGTTGT
146 58 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Luqi Huang
  • Email: huangluqi@263.net
  • Institution: Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, 100700 Beijing, China

References

  1. 1.0 1.1 1.2 Yang Y, Hou S, Cui G, et al. Characterization of reference genes for quantitative real-time PCR analysis in various tissues of Salvia miltiorrhiza[J]. Molecular biology reports, 2010, 37(1): 507-513.
  2. Han J Y, Fan J Y, Horie Y, et al. Ameliorating effects of compounds derived from Salvia miltiorrhiza root extract on microcirculatory disturbance and target organ injury by ischemia and reperfusion[J]. Pharmacology & therapeutics, 2008, 117(2): 280-295.