Difference between revisions of "Schistosoma japonicum"

From ICG
Jump to navigation Jump to search
Line 3: Line 3:
 
[[File:Schistosoma japonicum-1.png|right|327px|]]
 
[[File:Schistosoma japonicum-1.png|right|327px|]]
 
* Schistosomiasis is an important parasitic disease that ranks with malaria and tuberculosis in term of morbidity and mortality and infects more than 200 million people in 76 tropical and subtropical countries.  It has more than 40 mammalian animals as reservoir hosts that play a role in maintaining the parasite and increasing the chances for human infection. In China, there are several hundred thousand livestock, including over 200,000 buffalo currently infected<ref name="ref1"/> <ref name="ref2"/>.
 
* Schistosomiasis is an important parasitic disease that ranks with malaria and tuberculosis in term of morbidity and mortality and infects more than 200 million people in 76 tropical and subtropical countries.  It has more than 40 mammalian animals as reservoir hosts that play a role in maintaining the parasite and increasing the chances for human infection. In China, there are several hundred thousand livestock, including over 200,000 buffalo currently infected<ref name="ref1"/> <ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Blood fluke'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=6182 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Developmental Stages'''''==
 
=='''''Developmental Stages'''''==

Revision as of 01:49, 25 June 2017

Description

Schistosoma japonicum-1.png
  • Schistosomiasis is an important parasitic disease that ranks with malaria and tuberculosis in term of morbidity and mortality and infects more than 200 million people in 76 tropical and subtropical countries. It has more than 40 mammalian animals as reservoir hosts that play a role in maintaining the parasite and increasing the chances for human infection. In China, there are several hundred thousand livestock, including over 200,000 buffalo currently infected[1] [2].
  • Common Name: Blood fluke
  • NCBI Taxonomy

Developmental Stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PSMD4[1] 26S proteasome non-ATPase regulatory subunit 4
  • Universal reference gene
FN320595
  • F:CCTCACCAACAATTTCCACATCT
  • R:GATCACTTATAGCCTTGCGAACAT
129 60 SYBR
NDUFV2[1] NADH dehydrogenase (ubiquinone) flavoprotein 2
  • Universal reference gene
FN320220
  • F:CGAGGACCTAACAGCAGAGG
  • R:TCCGAACGAACTTTGAATCC
174 60 SYBR
TPC2L[1] Trafficking protein particle complex subunit 2-like protein
  • Universal reference gene
AY815746
  • F:TGGAACATTCTGATTGTGCCT
  • R:CGATGCCGTAATAGAACTAACA
140 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Qijun Chen
  • Email: qijun.chen@ipbcams.ac.cn
  • Institution: Institute of Pathogen Biology, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, China

Citation Statistics

Cited by 38 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 Liu S, Cai P, Hou N, et al. Genome-wide identification and characterization of a panel of house-keeping genes in Schistosoma japonicum[J]. Molecular and biochemical parasitology, 2012, 182(1): 75-82.
  2. Shuai Liu, Pengfei Cai, Nan Hou, Xianyu Piao, Heng Wang, Tao Hung, Qijun Chen. Genome-wide identification and characterization of a panel of house-keeping genes in Schistosoma japonicum. 0166-6851/$ – see front matter 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.molbiopara.2011.12.007 PMID: 22245333.