Difference between revisions of "Scophthalmus maximus"

From ICG
Jump to navigation Jump to search
 
(8 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
+
[[File:Scophthalmus maximus.png|right|200px|link=Scophthalmus maximus]]
[[File:Scophthalmus maximus-1.jpg|right|127px|]]
+
* '''''Scophthalmus maximus''''' is a flatfish that has been intensively cultured during the last decade due to its great commercial value. With 22 haploid chromosomes and one of the smallest genomes among cultured fishes (< 800 Mb), its production in Europe has increased from 3000 Tm in 1996 to 9246 Tm in 2009. As in many other cultured species, weight and length are traits of special interest. Size dispersion in turbot culture, mainly due to sexual dimorphism since females largely outgrow males, is another key issue for its farming<ref name="ref1"/><ref name="ref2"/>.
* Japanese flounder (Paralichthys olivaceus), a cold-water benthic flatfish, is important economic species cultured worldwide especially in Asia and Europe. In China, flounder farmings have expanded rapidly in recent years<ref name="ref1"/> <ref name="ref2"/>.
 
 
* <font color=blue>'''Common Name:'''</font> '''Turbot'''
 
* <font color=blue>'''Common Name:'''</font> '''Turbot'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=52904 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=52904 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Viral Infection'''''==
 
=='''''Viral Infection'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 110: Line 109:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
 +
 
===Molecular Types===
 
===Molecular Types===
 
*mRNA
 
*mRNA
Line 122: Line 122:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''15''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=487178205599622280&as_sdt=2005&sciodt=0,5&hl=en '''17'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 133: Line 133:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
  
 
[[Category:Animals]]
 
[[Category:Animals]]
Line 140: Line 141:
 
[[Category:ACT]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:ODC]] [[Category:RPL]] [[Category:RPS]] [[Category:Tubulin]]
 
[[Category:ACT]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:ODC]] [[Category:RPL]] [[Category:RPS]] [[Category:Tubulin]]
 
[[Category:Cold Treatment]]  [[Category:Biotic Stress]]  [[Category:Viral Infection]]  [[Category:Pathological conditions]]
 
[[Category:Cold Treatment]]  [[Category:Biotic Stress]]  [[Category:Viral Infection]]  [[Category:Pathological conditions]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 04:41, 1 September 2017

Description

Scophthalmus maximus.png
  • Scophthalmus maximus is a flatfish that has been intensively cultured during the last decade due to its great commercial value. With 22 haploid chromosomes and one of the smallest genomes among cultured fishes (< 800 Mb), its production in Europe has increased from 3000 Tm in 1996 to 9246 Tm in 2009. As in many other cultured species, weight and length are traits of special interest. Size dispersion in turbot culture, mainly due to sexual dimorphism since females largely outgrow males, is another key issue for its farming[1][2].
  • Common Name: Turbot
  • NCBI Taxonomy

Viral Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • 24h post-viral infection in GAPDH, heart, liver
  • 72h post-viral infection in heart, liver
DQ848904
  • F:CAGTGTATGAAGCCAGCAGAG
  • R:GGTCGTATTTGTCCTCATTAACTC
193 60 SYBR
RPL17[1] Ribosomal protein L17
  • 24h post-viral infection in brain
  • 72h post-viral infection in brain, gill
DQ848879
  • F:AACCTGCGAGTTCACTTCAAG
  • R:CCACGCCGCCATTGTAAC
142 60 SYBR
EF1A[1] Elongation factor-1-α
  • 24h post-viral infection in brain
  • 72h post-viral infection in brain, gill
AF467776
  • F:CGTCGGCTTCAACATCAAGAAC
  • R:GTGAGCGGTGTGGCAGTC
181 60 SYBR
RPSD[1] RNA polynerase II subunit D
  • 24h post-viral infection in gill, heart, intestine, kidney, spleen
  • 72h post-viral infection in liver, intestine, kidney, spleen
DQ848899
  • F:AACACAGGAAGCAGCAGAAC
  • R:ACGGCAGTGATGGTCTCTC
124 60 SYBR
ACTB[1] β-actin
  • 24h post-viral infection in liver
  • 72h post-viral infection in heart
EU686692
  • F:CGTGCGTGACATCAAGGAG
  • R:AGGAAGGAAGGCTGGAAGAG
177 60 SYBR
TUBA[1] α-tubulin
  • 24h post-viral infection in muscle
  • 72h post-viral infection in muscle
DQ848853
  • F:CGAGCCAGCCAACCAGATG
  • R:GATGGTGGCGATGGCAGAG
118 60 SYBR
ODC[1] Ornithine decarboxylase
  • 24h post-viral infection in spleen
  • 72h post-viral infection in spleen
DQ848853
  • F:TATGCCGAAGAACATCCTGAAG
  • R:GTCCCGCTCAAAGTTGTAGG
182 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Li Sun
  • Email: lsun@qdio.ac.cn
  • Institution: Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China

Citation Statistics

Cited by 17 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Zhang J, Hu Y, Sun B, et al. Selection of normalization factors for quantitative real time RT-PCR studies in Japanese flounder (Paralichthys olivaceus) and turbot (Scophthalmus maximus) under conditions of viral infection[J]. Veterinary immunology and immunopathology, 2013, 152(3): 303-316.
  2. Jinxiang Liu, Nayu Zhou, Ruixue Fu, Dandan Cao, Yu Si, Aoyun Li, Haitao Zhao, Quanqi Zhang, Haiyang Yu, The polymorphism of chicken-type lysozyme gene in Japanese flounder (Paralichthys olivaceus) and its association with resistance/susceptibility to Listonella anguillarum. Fish Shellfish Immunol. 2017 May 2;66:43-49. doi: 10.1016/j.fsi.2017.05.010. PMID: 28476668.

Categories