Scophthalmus maximus

From ICG
Jump to navigation Jump to search

Description

Scophthalmus maximus-1.jpg
  • Japanese flounder (Paralichthys olivaceus), a cold-water benthic flatfish, is important economic species cultured worldwide especially in Asia and Europe. In China, flounder farmings have expanded rapidly in recent years[1] [2].

Viral Infection

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • 24h post-viral infection in GAPDH, Heart, Liver
  • 72h post-viral infection in Heart, Liver
DQ848904
  • F:CAGTGTATGAAGCCAGCAGAG
  • R:GGTCGTATTTGTCCTCATTAACTC
193 60 SYBR
RPL17[1] Ribosomal protein L17
  • 24h post-viral infection in Brain
  • 72h post-viral infection in Brain, Gill
DQ848879
  • F:AACCTGCGAGTTCACTTCAAG
  • R:CCACGCCGCCATTGTAAC
142 60 SYBR
EF1A[1] Elongation factor-1-α
  • 24h post-viral infection in Brain
  • 72h post-viral infection in Brain, Gill
AF467776
  • F:CGTCGGCTTCAACATCAAGAAC
  • R:GTGAGCGGTGTGGCAGTC
181 60 SYBR
RPSD[1] RNA polynerase II subunit D
  • 24h post-viral infection in Gill, Heart, Intestine, Kidney, Spleen
  • 72h post-viral infection in Liver, Intestine, Kidney, Spleen
DQ848899
  • F:AACACAGGAAGCAGCAGAAC
  • R:ACGGCAGTGATGGTCTCTC
124 60 SYBR
ACTB[1] β-actin
  • 24h post-viral infection in Liver
  • 72h post-viral infection in Heart
EU686692
  • F:CGTGCGTGACATCAAGGAG
  • R:AGGAAGGAAGGCTGGAAGAG
177 60 SYBR
TUBA[1] α-Tubulin
  • 24h post-viral infection in Muscle
  • 72h post-viral infection in Muscle
DQ848853
  • F:CGAGCCAGCCAACCAGATG
  • R:GATGGTGGCGATGGCAGAG
118 60 SYBR
ODC[1] Ornithine decarboxylase
  • 24h post-viral infection in Spleen
  • 72h post-viral infection in Spleen
DQ848853
  • F:TATGCCGAAGAACATCCTGAAG
  • R:GTCCCGCTCAAAGTTGTAGG
182 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Li Sun
  • Email: lsun@qdio.ac.cn
  • Institution: Institute of Oceanology, Chinese Academy of Sciences, 7 Nanhai Road, Qingdao 266071, China

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Zhang J, Hu Y, Sun B, et al. Selection of normalization factors for quantitative real time RT-PCR studies in Japanese flounder (Paralichthys olivaceus) and turbot (Scophthalmus maximus) under conditions of viral infection[J]. Veterinary immunology and immunopathology, 2013, 152(3): 303-316.
  2. Jinxiang Liu, Nayu Zhou, Ruixue Fu, Dandan Cao, Yu Si, Aoyun Li, Haitao Zhao, Quanqi Zhang, Haiyang Yu, The polymorphism of chicken-type lysozyme gene in Japanese flounder (Paralichthys olivaceus) and its association with resistance/susceptibility to Listonella anguillarum. Fish Shellfish Immunol. 2017 May 2;66:43-49. doi: 10.1016/j.fsi.2017.05.010. PMID: 28476668