View source for Sedum alfredii

==Description==

[[File:Sedum alfredii.png|right|200px|link=Sedum alfredii]]
* '''''Sedum alfredii''''' is a plant found in an ancient, Chinese mining region near Quzhou (Zhejiang province) and has a strong ability to extract heavy metals from soil. ''S. alfredii'' was found to show heavy metal resistance and accumulation, as well as the ability to efficiently transport heavy metals from the root to the shoot. Roots of S. alfredii mainly produce malic acid, oxalic acid, and tartaric acid, presumably contributing to enhanced bioavailability of heavy metals<ref name="ref1"/> <ref name="ref2"/>.
* <font color=blue>'''Common Name:'''</font> '''Alfredii'''
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=439688 <font color=blue>'''NCBI Taxonomy'''</font>]

=='''''Different Heavy Metals Stresses'''''==
===Heavy Metals Treatments===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
|-
! Gene Symbol  
! Gene Name 
! style="width=25%　font-size:9pt　"|Application Scope 
! Accession Number 
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp] 
! Tm [℃]
! Detection
|-
|align="center"| UBC9<ref name="ref1"/>
|align="center"| Ubiquitin conjugating enzyme 9
|
* Cd, Pb, Zn, Cu heavy metal treatments
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF652106 '''KF652106'''] 
|nowrap style="font-size:9pt"|
* F:TGAGAAGGCAGCCACCTATG
* R:TGCTGTCACCCTGGAAGTCA
|align="center"|  198 
|align="center"| 60
|align="center"| SYBR
|-
|align="center"| TUB<ref name="ref1"/>
|align="center"| Beta-Tubulin
|
* Cd, Pb, Zn, Cu heavy metal treatments
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF652104 '''KF652104'''] 
|nowrap style="font-size:9pt"|
* F:TTATGGCGATTCCGAGCTTCA
* R:ATTATTTCCAGCGCCGGATTG
|align="center"|  193 
|align="center"| 60
|align="center"| SYBR
|}

===Molecular Types===
*mRNA

===Evaluation Methods=== 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
*  '''Ref-Finder method''' && [https://www.ncbi.nlm.nih.gov/pubmed/22290409 '''Related Reference''']
* '''ΔCt approach method''' && [https://www.ncbi.nlm.nih.gov/pubmed/17026756 '''Related Reference''']
===Contact===
*'''Name''': Renying Zhuo
*'''Email''': zhuory@gmail.com
*'''Institution''':  State Key Laboratory of Tree Genetics and Breeding, Beijing, China
===Citation Statistics===
Cited by '''10''' (Based on Google Scholar [2017-06-16])

=='''References'''==
<references>
<ref name="ref1">
KSang J, Han X, Liu M, et al. Selection and validation of reference genes for real-time quantitative PCR in hyperaccumulating ecotype of Sedum alfredii under different heavy metals stresses[J]. PloS one, 2013, 8(12): e82927.
</ref>
<ref name="ref2">
Li T, Tao Q, Liang C, Shohag MJ, Yang X, Sparks DL. Complexation with dissolved organic matter and mobility control of heavy metals in the rhizosphere  of hyperaccumulator Sedum alfredii. Environ Pollut. 2013 Nov;182:248-55. doi: 10.1016/j.envpol.2013.07.025. Epub 2013 Aug 10. PubMed PMID: 23938448.
</ref>
</references>
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
[[Category:Tubulin]] [[Category:Ubiquitin]][[Category:Heavy Metals Treatments]] [[Category:Abiotic Stress]]