Difference between revisions of "Sedum alfredii"

From ICG
Jump to: navigation, search
(Moleculer Types)
(Heavy Metals Treatments)
 
(23 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
  
[[File:Sedum alfredii-1.jpg|right|327px|]]
+
[[File:Sedum alfredii.png|right|200px|link=Sedum alfredii]]
* A member of the Crassulaceae, Sedum alfredii is a plant found in an ancient, Chinese mining region near Quzhou (Zhejiang province) and has a strong ability to extract heavy metals from soil. In previous studies, S. alfredii was found to show heavy metal resistance and accumulation, as well as the ability to efficiently transport heavy metals from the root to the shoot. Roots of S. alfredii mainly produce malic acid, oxalic acid, and tartaric acid, presumably contributing to enhanced bioavailability of heavy metals<ref name="ref1"/> <ref name="ref2"/>.
+
* '''''Sedum alfredii''''' is a plant found in an ancient Chinese mining region near Quzhou (Zhejiang Province) and has a strong ability to extract heavy metals from soil. ''S. alfredii'' was found to show heavy metal resistance and accumulation, as well as the ability to efficiently transport heavy metals from the root to the shoot. Its roots mainly produce malic acid, oxalic acid, and tartaric acid, presumably contributing to enhanced bioavailability of heavy metals <ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Alfredii'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=439688 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Heavy Metals Stresses'''''==
 
=='''''Different Heavy Metals Stresses'''''==
Line 20: Line 22:
 
|align="center"| Ubiquitin conjugating enzyme 9
 
|align="center"| Ubiquitin conjugating enzyme 9
 
|
 
|
* Universal reference gene
+
* Cd, Pb, Zn, Cu treatments
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF652106 '''KF652106''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF652106 '''KF652106''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 30: Line 32:
 
|-
 
|-
 
|align="center"| TUB<ref name="ref1"/>
 
|align="center"| TUB<ref name="ref1"/>
|align="center"| Beta-Tubulin
+
|align="center"| Beta-tubulin
 
|
 
|
* Universal reference gene
+
* Cd, Pb, Zn, Cu treatments
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF652104 '''KF652104''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF652104 '''KF652104''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 38: Line 40:
 
* R:ATTATTTCCAGCGCCGGATTG
 
* R:ATTATTTCCAGCGCCGGATTG
 
|align="center"|  193  
 
|align="center"|  193  
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| ACT2<ref name="ref1"/>
 +
|align="center"| Actin-2
 +
|
 +
* Cd and Cu treatments
 +
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF652103 '''KF652103''']
 +
|nowrap style="font-size:9pt"|
 +
* F:TTCCGGTGATGGTGTCAGTCA
 +
* R:ACAATTTCCCGCTCAGCAGTG
 +
|align="center"|  165
 
|align="center"| 60
 
|align="center"| 60
 
|align="center"| SYBR
 
|align="center"| SYBR
Line 49: Line 63:
 
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
*  '''Ref-Finder method''' && [https://www.ncbi.nlm.nih.gov/pubmed/22290409 '''Related Reference''']
+
 
* '''ΔCt approach method''' && [https://www.ncbi.nlm.nih.gov/pubmed/17026756 '''Related Reference''']
 
 
===Contact===
 
===Contact===
 
*'''Name''': Renying Zhuo
 
*'''Name''': Renying Zhuo
Line 56: Line 69:
 
*'''Institution''':  State Key Laboratory of Tree Genetics and Breeding, Beijing, China
 
*'''Institution''':  State Key Laboratory of Tree Genetics and Breeding, Beijing, China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''10''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=4665472933885746279&as_sdt=2005&sciodt=0,5&hl=en'''12'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
KSang J, Han X, Liu M, et al. Selection and validation of reference genes for real-time quantitative PCR in hyperaccumulating ecotype of Sedum alfredii under different heavy metals stresses[J]. PloS one, 2013, 8(12): e82927.
+
Sang J, Han X, Liu M, et al. Selection and validation of reference genes for real-time quantitative PCR in hyperaccumulating ecotype of Sedum alfredii under different heavy metals stresses[J]. PloS one, 2013, 8(12): e82927.
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
Line 67: Line 80:
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
+
 
[[Category:Tubulin]] [[Category:Ubiquitin]]
+
=='''Categories'''==
[[Category:Heavy Metals Treatments],[[Category:Abiotic Stress]]
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:Tubulin]][[Category:Ubiquitin]][[Category:Heavy Metals Treatments]][[Category:Abiotic Stress]][[Category:geNorm]][[Category:NormFinder]][[Category:BestKeeper]]

Latest revision as of 06:38, 4 September 2017

Description

Sedum alfredii.png
  • Sedum alfredii is a plant found in an ancient Chinese mining region near Quzhou (Zhejiang Province) and has a strong ability to extract heavy metals from soil. S. alfredii was found to show heavy metal resistance and accumulation, as well as the ability to efficiently transport heavy metals from the root to the shoot. Its roots mainly produce malic acid, oxalic acid, and tartaric acid, presumably contributing to enhanced bioavailability of heavy metals [1][2].
  • Common Name: Alfredii
  • NCBI Taxonomy

Different Heavy Metals Stresses

Heavy Metals Treatments

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UBC9[1] Ubiquitin conjugating enzyme 9
  • Cd, Pb, Zn, Cu treatments
KF652106
  • F:TGAGAAGGCAGCCACCTATG
  • R:TGCTGTCACCCTGGAAGTCA
198 60 SYBR
TUB[1] Beta-tubulin
  • Cd, Pb, Zn, Cu treatments
KF652104
  • F:TTATGGCGATTCCGAGCTTCA
  • R:ATTATTTCCAGCGCCGGATTG
193 60 SYBR
ACT2[1] Actin-2
  • Cd and Cu treatments
KF652103
  • F:TTCCGGTGATGGTGTCAGTCA
  • R:ACAATTTCCCGCTCAGCAGTG
165 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Renying Zhuo
  • Email: zhuory@gmail.com
  • Institution: State Key Laboratory of Tree Genetics and Breeding, Beijing, China

Citation Statistics

Cited by 12 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Sang J, Han X, Liu M, et al. Selection and validation of reference genes for real-time quantitative PCR in hyperaccumulating ecotype of Sedum alfredii under different heavy metals stresses[J]. PloS one, 2013, 8(12): e82927.
  2. Li T, Tao Q, Liang C, Shohag MJ, Yang X, Sparks DL. Complexation with dissolved organic matter and mobility control of heavy metals in the rhizosphere of hyperaccumulator Sedum alfredii. Environ Pollut. 2013 Nov;182:248-55. doi: 10.1016/j.envpol.2013.07.025. Epub 2013 Aug 10. PubMed PMID: 23938448.

Categories