Difference between revisions of "Sedum alfredii"
From ICG
ICG Expert4 (talk | contribs) (→References) |
ICG Expert1 (talk | contribs) (→Heavy Metals Treatments) |
||
| (21 intermediate revisions by 6 users not shown) | |||
| Line 1: | Line 1: | ||
==Description== | ==Description== | ||
| − | [[File:Sedum alfredii | + | [[File:Sedum alfredii.png|right|200px|link=Sedum alfredii]] |
| − | * | + | * '''''Sedum alfredii''''' is a plant found in an ancient Chinese mining region near Quzhou (Zhejiang Province) and has a strong ability to extract heavy metals from soil. ''S. alfredii'' was found to show heavy metal resistance and accumulation, as well as the ability to efficiently transport heavy metals from the root to the shoot. Its roots mainly produce malic acid, oxalic acid, and tartaric acid, presumably contributing to enhanced bioavailability of heavy metals <ref name="ref1"/><ref name="ref2"/>. |
| + | * <font color=blue>'''Common Name:'''</font> '''Alfredii''' | ||
| + | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=439688 <font color=blue>'''NCBI Taxonomy'''</font>] | ||
=='''''Different Heavy Metals Stresses'''''== | =='''''Different Heavy Metals Stresses'''''== | ||
| Line 20: | Line 22: | ||
|align="center"| Ubiquitin conjugating enzyme 9 | |align="center"| Ubiquitin conjugating enzyme 9 | ||
| | | | ||
| − | * | + | * Cd, Pb, Zn, Cu treatments |
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF652106 '''KF652106'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF652106 '''KF652106'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
| Line 30: | Line 32: | ||
|- | |- | ||
|align="center"| TUB<ref name="ref1"/> | |align="center"| TUB<ref name="ref1"/> | ||
| − | |align="center"| Beta- | + | |align="center"| Beta-tubulin |
| | | | ||
| − | * | + | * Cd, Pb, Zn, Cu treatments |
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF652104 '''KF652104'''] | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF652104 '''KF652104'''] | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
| Line 38: | Line 40: | ||
* R:ATTATTTCCAGCGCCGGATTG | * R:ATTATTTCCAGCGCCGGATTG | ||
|align="center"| 193 | |align="center"| 193 | ||
| + | |align="center"| 60 | ||
| + | |align="center"| SYBR | ||
| + | |- | ||
| + | |align="center"| ACT2<ref name="ref1"/> | ||
| + | |align="center"| Actin-2 | ||
| + | | | ||
| + | * Cd and Cu treatments | ||
| + | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KF652103 '''KF652103'''] | ||
| + | |nowrap style="font-size:9pt"| | ||
| + | * F:TTCCGGTGATGGTGTCAGTCA | ||
| + | * R:ACAATTTCCCGCTCAGCAGTG | ||
| + | |align="center"| 165 | ||
|align="center"| 60 | |align="center"| 60 | ||
|align="center"| SYBR | |align="center"| SYBR | ||
| Line 49: | Line 63: | ||
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference'''] | * [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference'''] | ||
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference'''] | * [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference'''] | ||
| − | + | ||
| − | |||
===Contact=== | ===Contact=== | ||
*'''Name''': Renying Zhuo | *'''Name''': Renying Zhuo | ||
| Line 56: | Line 69: | ||
*'''Institution''': State Key Laboratory of Tree Genetics and Breeding, Beijing, China | *'''Institution''': State Key Laboratory of Tree Genetics and Breeding, Beijing, China | ||
===Citation Statistics=== | ===Citation Statistics=== | ||
| − | Cited by ''' | + | Cited by [https://scholar.google.com/scholar?cites=4665472933885746279&as_sdt=2005&sciodt=0,5&hl=en'''12'''] (Based on Google Scholar [2017-09-01]) |
=='''References'''== | =='''References'''== | ||
<references> | <references> | ||
<ref name="ref1"> | <ref name="ref1"> | ||
| − | + | Sang J, Han X, Liu M, et al. Selection and validation of reference genes for real-time quantitative PCR in hyperaccumulating ecotype of Sedum alfredii under different heavy metals stresses[J]. PloS one, 2013, 8(12): e82927. | |
</ref> | </ref> | ||
<ref name="ref2"> | <ref name="ref2"> | ||
| Line 67: | Line 80: | ||
</ref> | </ref> | ||
</references> | </references> | ||
| − | [[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]] | + | |
| − | [[Category:Tubulin]] [[Category:Ubiquitin]][[Category:Heavy Metals Treatments] [[Category:Abiotic Stress]] | + | =='''Categories'''== |
| + | [[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:Tubulin]][[Category:Ubiquitin]][[Category:Heavy Metals Treatments]][[Category:Abiotic Stress]][[Category:geNorm]][[Category:NormFinder]][[Category:BestKeeper]] | ||
Latest revision as of 06:38, 4 September 2017
Contents
Description
- Sedum alfredii is a plant found in an ancient Chinese mining region near Quzhou (Zhejiang Province) and has a strong ability to extract heavy metals from soil. S. alfredii was found to show heavy metal resistance and accumulation, as well as the ability to efficiently transport heavy metals from the root to the shoot. Its roots mainly produce malic acid, oxalic acid, and tartaric acid, presumably contributing to enhanced bioavailability of heavy metals [1][2].
- Common Name: Alfredii
- NCBI Taxonomy
Different Heavy Metals Stresses
Heavy Metals Treatments
| Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
|---|---|---|---|---|---|---|---|
| UBC9[1] | Ubiquitin conjugating enzyme 9 |
|
KF652106 |
|
198 | 60 | SYBR |
| TUB[1] | Beta-tubulin |
|
KF652104 |
|
193 | 60 | SYBR |
| ACT2[1] | Actin-2 |
|
KF652103 |
|
165 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Renying Zhuo
- Email: zhuory@gmail.com
- Institution: State Key Laboratory of Tree Genetics and Breeding, Beijing, China
Citation Statistics
Cited by 12 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 1.3 Sang J, Han X, Liu M, et al. Selection and validation of reference genes for real-time quantitative PCR in hyperaccumulating ecotype of Sedum alfredii under different heavy metals stresses[J]. PloS one, 2013, 8(12): e82927.
- ↑ Li T, Tao Q, Liang C, Shohag MJ, Yang X, Sparks DL. Complexation with dissolved organic matter and mobility control of heavy metals in the rhizosphere of hyperaccumulator Sedum alfredii. Environ Pollut. 2013 Nov;182:248-55. doi: 10.1016/j.envpol.2013.07.025. Epub 2013 Aug 10. PubMed PMID: 23938448.
