Sedum alfredii

From ICG
Revision as of 07:26, 16 June 2017 by ICG Expert4 (talk | contribs) (Created page with "==Description== =='''''Different Heavy Metals Stresses'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

Description

Different Heavy Metals Stresses

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
UBC9[1] Ubiquitin conjugating enzyme 9
  • Universal reference gene
KF652106
  • F:TGAGAAGGCAGCCACCTATG
  • R:TGCTGTCACCCTGGAAGTCA
198 60 SYBR
TUB[1] beta-Tubulin
  • Universal reference gene
KF652104
  • F:TTATGGCGATTCCGAGCTTCA
  • R:ATTATTTCCAGCGCCGGATTG
193 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Renying Zhuo
  • Email: zhuory@gmail.com
  • Institution: State Key Laboratory of Tree Genetics and Breeding, Beijing, China

References

  1. 1.0 1.1 KSang J, Han X, Liu M, et al. Selection and validation of reference genes for real-time quantitative PCR in hyperaccumulating ecotype of Sedum alfredii under different heavy metals stresses[J]. PloS one, 2013, 8(12): e82927.