Difference between revisions of "Sesamia inferens"

Revision as of 08:52, 17 August 2017

The pink stem borer, Sesamia inferens (Walker) (Lepidoptera: Noctuidae), is a major pest of rice in China and other Asian countries. Recently, damage incited by S. inferens has become more serious. In addition, based on researchers' investigation, the pest now occurs in more northern regions of China (unpublished data) ^[1].
Common Name: purple stem borer
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
RPS13^[1]	Ribosomal protein S13	Head,epidermis, fat body, foregut, midgut, hindgut, Malpighiantubules, haemocytes, and salivary glands	NA	F:TGGTAAGGGTATCTCCCAATCA R:TCGTCAGCAGTCAGTTTCAGC	75	60.1	SYBR
RPS20^[1]	Ribosomal protein S20	Head,epidermis, fat body, foregut, midgut, hindgut, Malpighiantubules, haemocytes Different temperatures and salivary glands	NA	F:CTCATCAATGGAGCCAAGAAAC R:GTGCAGGTCAATGACACGCT	162	60.1	SYBR
EF1^[1]	Elongation factor 1	Head,epidermis, fat body, foregut, midgut, hindgut, Malpighiantubules, haemocytes Developmental stages and sex and salivary glands	NA	F:GTCGCTTTCGTACCCATTTCT R:ACAGTCCATCCCTTGAACCAG	86	56.6	SYBR
18S^[1]	18S ribosomal RNA	Developmental stages and sex Different temperatures	NA	F:CAACACGGGAAATCTCACCA R:GACAAATCGCTCCACCAACTAA	115	55.6	SYBR
GAPDH^[1]	glyceraldehyde-3 phosphate dehydrogenase	Developmental stages and sex	NA	F:GGTCATCTCCAACGCTTCCT R:ACGTCCATCACGCCACAAT	166	56.6	SYBR
TUB^[1]	tubulin	Different temperatures	NA	F:TTGCTACAGAACCCTCAAAGTGC R:AGACGTGGGAACGGAACCAT	159	59.2	SYBR

Name: Yu-Zhou Du
Email: yzdu@yzu.edu.cn
Institution: School of Horticulture and Plant Protection & Institute of Applied Entomology, Yangzhou University, Yangzhou, Jiangsu, China

Cited by 19 (Based on Google Scholar [2017-08-10])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 Sun M, Lu MX, Tang XT, Du YZ. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae). PLoS One. 2015 Jan 13;10(1):e0115979. doi: 10.1371/journal.pone.0115979. eCollection 2015. PubMed PMID: 25585250; PubMed Central PMCID: PMC4293147.

@@ Line 104: / Line 104: @@
 *'''Name''': Yu-Zhou Du
 *'''Email''': yzdu@yzu.edu.cn
-*'''Institute''': School of Horticulture and Plant Protection & Institute of Applied Entomology, Yangzhou University, Yangzhou, Jiangsu, China
+*'''Institution''': School of Horticulture and Plant Protection & Institute of Applied Entomology, Yangzhou University, Yangzhou, Jiangsu, China
 ===Citation Statistics===
 Cited by '''19''' (Based on Google Scholar [2017-08-10])