Sesamia inferens

From ICG
Jump to navigation Jump to search

Description

Sesamia inferens-1.jpg
  • The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant.
  • Recently, damage incited by S. inferens has become more serious. In addition, based on our investigation, the pest now occurs in more northern regions of China (unpublished data). [1]
  • Common Name: purple stem borer
  • NCBI Taxonomy

Different Tissues & Developmental Stages

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPS13[1] Ribosomal protein S13
  • Head,epidermis, fat body, foregut, midgut, hindgut, Malpighiantubules, haemocytes, and salivary glands
NA
  • F:TGGTAAGGGTATCTCCCAATCA
  • R:TCGTCAGCAGTCAGTTTCAGC
75 60.1 SYBR
RPS20[1] Ribosomal protein S20
  • Head,epidermis, fat body, foregut, midgut, hindgut, Malpighiantubules, haemocytes
  • Different temperatures and salivary glands
NA
  • F:CTCATCAATGGAGCCAAGAAAC
  • R:GTGCAGGTCAATGACACGCT
162 60.1 SYBR
EF1[1] Elongation factor 1
  • Head,epidermis, fat body, foregut, midgut, hindgut, Malpighiantubules, haemocytes
  • Developmental stages and sex and salivary glands
NA
  • F:GTCGCTTTCGTACCCATTTCT
  • R:ACAGTCCATCCCTTGAACCAG
86 56.6 SYBR
18S[1] 18S ribosomal RNA
  • Developmental stages and sex
  • Different temperatures
NA
  • F:CAACACGGGAAATCTCACCA
  • R:GACAAATCGCTCCACCAACTAA
115 55.6 SYBR
GAPDH[1] glyceraldehyde-3 phosphate dehydrogenase
  • Developmental stages and sex
NA
  • F:GGTCATCTCCAACGCTTCCT
  • R:ACGTCCATCACGCCACAAT
166 56.6 SYBR
TUB[1] tubulin
  • Different temperatures
NA
  • F:TTGCTACAGAACCCTCAAAGTGC
  • R:AGACGTGGGAACGGAACCAT
159 59.2 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Yu-Zhou Du
  • Email: yzdu@yzu.edu.cn
  • Institute: School of Horticulture and Plant Protection & Institute of Applied Entomology, Yangzhou University, Yangzhou, Jiangsu, China

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Sun M, Lu MX, Tang XT, Du YZ. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae). PLoS One. 2015 Jan 13;10(1):e0115979. doi: 10.1371/journal.pone.0115979. eCollection 2015. PubMed PMID: 25585250; PubMed Central PMCID: PMC4293147.

Categories