Sesamum indicum

From ICG
Revision as of 07:21, 16 June 2017 by ICG Expert4 (talk | contribs) (Created page with "==Description== right|327px| * Sesame is an important oilseed crop of the world, India being a major producer. Sesame seed provides a highly st...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Sesamum indicum-1.jpg
  • Sesame is an important oilseed crop of the world, India being a major producer. Sesame seed provides a highly stable oil and nutritious protein and meal and is used in confectionery foods. It is also an ingredient in Ayurvedic oils under the Indian System of medicine. Sesame is reported to possess antiaging properties, hypocholesterolemic effect, alleviation of symptoms of alcohol withdrawal, etc. Phytochemical investigation of sesame has revealed the presence of biologically active compounds, namely, lignans and lignan glucosides. Studies have shown that sesamin, the major compound present in sesame, inhibits cholesterol absorption and synthesis in rats. Other compounds such as sesamol and sesaminol are reported to be responsible for the increased stability of sesame oil[1] [2] [3][4] [5].

Seed Development, Anther Sterility & Plant Development

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
SiUBQ6[1] Ubiquitin 6
  • Sesame plant development, bud development
JP631638
  • F:CACCAAGCCGAAGAAGATCAAG
  • R:CCTCAGCCTCTGCACCTTTC
100 59~60 SYBR
SiAPT[1] Adenine phosphoribosyl transferase 1
  • Sesame plant development
  • Hormone treatment and seed development
JP631638
  • F:TTGCCAATGGACAAAGGGTT
  • R:GAGGGTCGGGTCAAGTTAGG
228 60.9~61.5 SYBR
SiTUB[1] β-tubulin
  • Sesame vegetative tissue development
  • hormone treatment and seed development
JP631640
  • F:TGGTGACCTCAACCACCTCAT
  • R:TGACAGCGAGTTTCCTGAGATC
101 58.0~59.0 SYBR
SiDNAJ[1] DnaJ protein-like
  • Pathogen treatment
  • Hormone treatment and seed development
JP631642
  • F:CAAAATGGTCCGTTCACACTT
  • R:CTGTTTTTGTCCCTTTCACCA
118 59.9~60.0 SYBR
SiACT[1] Actin 7
  • Seed germination
  • Hormone treatment and seed development
JP631637
  • F:CTCCCTTTATGCCAGTGGTCGT
  • R:GCTCAGCTGTTGTAGTGAAGGA
197 58.2~61.5 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Haiyang Zhang
  • Email: zhy@hnagri.org.cn
  • Institution: Henan Sesame Research Center, Henan Academy of Agricultural Sciences, Zhengzhou 450002, Henan, People’s Republic of China

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Wei L, Miao H, Zhao R, et al. Identification and testing of reference genes for Sesame gene expression analysis by quantitative real-time PCR[J]. Planta, 2013, 237(3): 873-889.
  2. Namiki, M. The chemistry and physiological function of sesame. Food ReV. Int. 1995,11, 281-329.
  3. Fukuda, Y.; Osawa, T.; Namiki, M.; Ozaki, T. Studies on antioxidative substances in sesame. Agric. Biol. Chem. 1985, 49, 301-306.
  4. Hirose, N.; Inoue, T.; Nishihara, K.; Sugano, M.; Akimoto, K.; Shimizu, S.; Yamada, H. Inhibition of cholesterol absorption and synthesis in rats by sesamin. J. Lipid Res. 1991, 32, 629-638.
  5. Fukuda, Y.; Nagata, M.; Osawa, T.; Namiki, M. Chemical aspects of the antioxidative activity of roasted sesame seed oil, and the effect of using the oil for frying. Agric. Biol. Chem. 1986, 50, 857-862.