Difference between revisions of "Setaria italica"

From ICG
Jump to navigation Jump to search
 
(20 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:REFqPCRSetaria_italica.jpg|right|327px|]]
+
[[File:Setaria italica.png|right|200px|link=Setaria italica]]
*Setaria viridis is a species of grass that is a member of the Panicoid family, which is the most economically important family of grass species, and includes maize, sorghum and sugarcane. Each of the above listed members of the Panicoid family undergoes C4 photosynthesis of carbon capture and fixation.  
+
*'''''Setaria viridis''''' is is a species of grass that is a member of the Panicoid family. It is native to Eurasia, but it is known on most continents as an introduced species and is closely related to Setaria faberi. It is a hardy grass which grows in many types of urban, cultivated, and disturbed habitat, including vacant lots, sidewalks, railroads, lawns, and at the margins of fields. It is the wild antecedent of the crop foxtail millet. It is the most economically important family of grass species that has been proposed as a model to study C4 photosynthesis and related bioenergy grasses<ref name="ref1"/><ref name="ref2"/>.
*They are also morphologically characterized as having Kranz anatomy, such that bundle-sheath (BS) and mesophyll (M) cells arranged in concentric circles around the vascular bundles of the leaves.
+
* <font color=blue>'''Common Name:'''</font> '''Foxtail millet'''
*C4 photosynthesis can be subdivided into three main subtypes, which are biochemically distinct. In the case of S. viridis, atmospheric CO2 is first fixed in the M cytoplasm by PEPC (phosphoenol-pyruvate carboxylase), and after chemical modifications it is transformed into a four-carbon compound (malate).
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4555 <font color=blue>'''NCBI Taxonomy'''</font>]
*The malate is then transported into BS chloroplasts where the decarboxylation step is performed mainly by the NADP-dependent malic enzyme (NADP-ME), leading to the release of CO2 close to the active site of the RuBisCO enzyme.  
 
*In C4 plants, RuBisCO is confined to BS cells, and this partitioning of carbon assimilation and carbon fixation steps greatly reduces the losses caused by photorespiration. Such an arrangement enables these plants to more efficiently use water and nitrogen, especially in hot and dry environments.
 
  
=='''Dehydration Stress'''==
+
=='''Dehydration & Salinity Treatment'''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 15: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
 
! Detection
 
! Detection
 
|-
 
|-
|align="center"| Act2<ref name="ref1"/><ref name="ref2"/>
+
|align="center"| Act2<ref name="ref1"/>
 
|align="center"| Actin2
 
|align="center"| Actin2
 
|
 
|
* Salinity stress
+
* Salinity treatment
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/944228829 '''Si026509m''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/944228829 '''Si026509m''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 35: Line 33:
 
|align="center"| RNA polymerase II
 
|align="center"| RNA polymerase II
 
|
 
|
* Salinity stress
+
* Salinity treatment
 
*Dehydration stress
 
*Dehydration stress
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/944257849 '''Si033113m''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/944257849 '''Si033113m''']  
Line 48: Line 46:
 
|align="center"| Elongation factor 1-alpha
 
|align="center"| Elongation factor 1-alpha
 
|
 
|
* Dehydration stress
+
* Dehydration treatment
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JC726592.1 '''Si022039m''']  
 
|align="center"|  [https://www.ncbi.nlm.nih.gov/nuccore/JC726592.1 '''Si022039m''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 58: Line 56:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 68: Line 66:
 
*'''Name''': Manoj Prasad
 
*'''Name''': Manoj Prasad
 
*'''Email''': manoj_prasad@nipgr.ac.in
 
*'''Email''': manoj_prasad@nipgr.ac.in
*'''Institute''':  National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, JNU Campus, New Delhi 110 067, India
+
*'''Institution''':  National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, JNU Campus, New Delhi 110 067, India
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''38''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=13896468661831971684&as_sdt=2005&sciodt=0,5&hl=en'''39'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 81: Line 80:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
[[Category:Plants]]
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:ACT]][[Category:EF1α]][[Category:polA]][[Category:Dehydration Treatment]][[Category:Salinity Treatment]]
 +
[[Category:geNorm]][[Category:NormFinder]]

Latest revision as of 07:31, 1 September 2017

Description

Setaria italica.png
  • Setaria viridis is is a species of grass that is a member of the Panicoid family. It is native to Eurasia, but it is known on most continents as an introduced species and is closely related to Setaria faberi. It is a hardy grass which grows in many types of urban, cultivated, and disturbed habitat, including vacant lots, sidewalks, railroads, lawns, and at the margins of fields. It is the wild antecedent of the crop foxtail millet. It is the most economically important family of grass species that has been proposed as a model to study C4 photosynthesis and related bioenergy grasses[1][2].
  • Common Name: Foxtail millet
  • NCBI Taxonomy

Dehydration & Salinity Treatment

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Act2[1] Actin2
  • Salinity treatment
Si026509m
  • F:CGCATATGTGGCTCTTGACT
  • R: GGGCACCTAAATCTCTCTGC
126 60 SYBR
RNA POL II[1] RNA polymerase II
  • Salinity treatment
  • Dehydration stress
Si033113m
  • F: TAGGAAAGGAATTGGCAAGG
  • R: TAGGACTGCTTTCGACCCA
146 60 SYBR
EF-1a [1] Elongation factor 1-alpha
  • Dehydration treatment
Si022039m
  • F:TGACTGTGCTGTCCTCATCA
  • R:GTTGCAGCAGCAAATCATCT
133 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Manoj Prasad
  • Email: manoj_prasad@nipgr.ac.in
  • Institution: National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, JNU Campus, New Delhi 110 067, India

Citation Statistics

Cited by 39 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Kumar K, Muthamilarasan M, Prasad M. Reference genes for quantitative real-time PCR analysis in the model plant foxtail millet (Setariaitalica L.) subjected to abiotic stress conditions[J]. Plant Cell, Tissue and Organ Culture (PCTOC), 2013, 115(1): 13-22.
  2. Julia Lambret-Frotté, Leandro C. S. de Almeida, Stéfanie M. de Moura, Flavio L. F. Souza, Francisco S. Validating Internal Control Genes for the Accurate Normalization of qPCR Expression Analysis of the Novel Model Plant Setaria viridis. PLoS One. 2015; 10(8): e0135006.doi: 10.1371/journal.pone.0135006. PMCID: PMC4527663.

Categories