Difference between revisions of "Setaria italica"

Revision as of 15:47, 27 June 2017

Setaria viridis is is a species of grass that is a member of the Panicoid family. It is native to Eurasia, but it is known on most continents as an introduced species and is closely related to Setaria faberi. It is a hardy grass which grows in many types of urban, cultivated, and disturbed habitat, including vacant lots, sidewalks, railroads, lawns, and at the margins of fields. It is the wild antecedent of the crop foxtail millet. It is the most economically important family of grass species that has been proposed as a model to study C4 photosynthesis and related bioenergy grasses.
Common Name: Foxtail millet
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Act2^[1]	Actin2	Salinity treatment	Si026509m	F:CGCATATGTGGCTCTTGACT R: GGGCACCTAAATCTCTCTGC	126	60	SYBR
RNA POL II^[1]	RNA polymerase II	Salinity treatment Dehydration stress	Si033113m	F: TAGGAAAGGAATTGGCAAGG R: TAGGACTGCTTTCGACCCA	146	60	SYBR
EF-1a ^[1]	Elongation factor 1-alpha	Dehydration treatment	Si022039m	F:TGACTGTGCTGTCCTCATCA R:GTTGCAGCAGCAAATCATCT	133	60	SYBR

Name: Manoj Prasad
Email: manoj_prasad@nipgr.ac.in
Institution: National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, JNU Campus, New Delhi 110 067, India

Cited by 38 (Based on Google Scholar [2017-06-16])

↑ ^1.0 ^1.1 ^1.2 Kumar K, Muthamilarasan M, Prasad M. Reference genes for quantitative real-time PCR analysis in the model plant foxtail millet (Setariaitalica L.) subjected to abiotic stress conditions[J]. Plant Cell, Tissue and Organ Culture (PCTOC), 2013, 115(1): 13-22.

Cite error: <ref> tag with name "ref2" defined in <references> is not used in prior text.　

@@ Line 18: / Line 18: @@
 ! Detection
 |-
-|align="center"| Act2<ref name="ref1"/><ref name="ref2"/>
+|align="center"| Act2<ref name="ref1"/>
 |align="center"| Actin2
 |