Difference between revisions of "Setaria italica"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''Dehydration Stress'''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene symbol ! Gene name ! styl...")
 
Line 69: Line 69:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
[[Category:Plants]]

Revision as of 10:13, 16 June 2017

Description

Dehydration Stress

Reference Genes

Gene symbol Gene name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Act2[1] Actin2
  • salinity stress
Si026509m
  • F:CGCATATGTGGCTCTTGACT
  • R: GGGCACCTAAATCTCTCTGC
126 60 SYBR
RNA POL II[1] RNA polymerase II
  • salinity stress
  • dehydration stress
Si033113m
  • F: TAGGAAAGGAATTGGCAAGG
  • R: TAGGACTGCTTTCGACCCA
146 60 SYBR
EF-1a [1] Elongation factor 1-alpha
  • dehydration stress
Si022039m
  • F:TGACTGTGCTGTCCTCATCA
  • R:GTTGCAGCAGCAAATCATCT
133 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Manoj Prasad
  • Email: manoj_prasad@nipgr.ac.in
  • Institute: National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, JNU Campus, New Delhi 110 067, India

References

  1. 1.0 1.1 1.2 Kumar K, Muthamilarasan M, Prasad M. Reference genes for quantitative real-time PCR analysis in the model plant foxtail millet (Setariaitalica L.) subjected to abiotic stress conditions[J]. Plant Cell, Tissue and Organ Culture (PCTOC), 2013, 115(1): 13-22.