Difference between revisions of "Setaria italica"

From ICG
Jump to navigation Jump to search
Line 4: Line 4:
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
! Gene symbol  
+
! Gene Symbol  
! Gene name
+
! Gene Name
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
Line 51: Line 51:
 
|}
 
|}
  
===Moleculer types===
+
===Moleculer Types===
 
* mRNA
 
* mRNA
  
Line 62: Line 62:
 
*'''Email''': manoj_prasad@nipgr.ac.in
 
*'''Email''': manoj_prasad@nipgr.ac.in
 
*'''Institute''':  National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, JNU Campus, New Delhi 110 067, India
 
*'''Institute''':  National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, JNU Campus, New Delhi 110 067, India
 +
===Citation Statistics===
 +
Cited by '''38''' (Based on Google Scholar [2017-06-16])
  
 
=='''References'''==
 
=='''References'''==

Revision as of 10:14, 16 June 2017

Description

Dehydration Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Act2[1] Actin2
  • salinity stress
Si026509m
  • F:CGCATATGTGGCTCTTGACT
  • R: GGGCACCTAAATCTCTCTGC
126 60 SYBR
RNA POL II[1] RNA polymerase II
  • salinity stress
  • dehydration stress
Si033113m
  • F: TAGGAAAGGAATTGGCAAGG
  • R: TAGGACTGCTTTCGACCCA
146 60 SYBR
EF-1a [1] Elongation factor 1-alpha
  • dehydration stress
Si022039m
  • F:TGACTGTGCTGTCCTCATCA
  • R:GTTGCAGCAGCAAATCATCT
133 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Manoj Prasad
  • Email: manoj_prasad@nipgr.ac.in
  • Institute: National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, JNU Campus, New Delhi 110 067, India

Citation Statistics

Cited by 38 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Kumar K, Muthamilarasan M, Prasad M. Reference genes for quantitative real-time PCR analysis in the model plant foxtail millet (Setariaitalica L.) subjected to abiotic stress conditions[J]. Plant Cell, Tissue and Organ Culture (PCTOC), 2013, 115(1): 13-22.