Difference between revisions of "Setaria italica"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 +
[[File:REFqPCRSetaria_italica.jpg|right|327px|]]
 
*Setaria viridis is a species of grass that is a member of the Panicoid family, which is the most economically important family of grass species, and includes maize, sorghum and sugarcane. Each of the above listed members of the Panicoid family undergoes C4 photosynthesis of carbon capture and fixation.  
 
*Setaria viridis is a species of grass that is a member of the Panicoid family, which is the most economically important family of grass species, and includes maize, sorghum and sugarcane. Each of the above listed members of the Panicoid family undergoes C4 photosynthesis of carbon capture and fixation.  
 
*They are also morphologically characterized as having Kranz anatomy, such that bundle-sheath (BS) and mesophyll (M) cells arranged in concentric circles around the vascular bundles of the leaves.  
 
*They are also morphologically characterized as having Kranz anatomy, such that bundle-sheath (BS) and mesophyll (M) cells arranged in concentric circles around the vascular bundles of the leaves.  

Revision as of 12:00, 16 June 2017

Description

REFqPCRSetaria italica.jpg
  • Setaria viridis is a species of grass that is a member of the Panicoid family, which is the most economically important family of grass species, and includes maize, sorghum and sugarcane. Each of the above listed members of the Panicoid family undergoes C4 photosynthesis of carbon capture and fixation.
  • They are also morphologically characterized as having Kranz anatomy, such that bundle-sheath (BS) and mesophyll (M) cells arranged in concentric circles around the vascular bundles of the leaves.
  • C4 photosynthesis can be subdivided into three main subtypes, which are biochemically distinct. In the case of S. viridis, atmospheric CO2 is first fixed in the M cytoplasm by PEPC (phosphoenol-pyruvate carboxylase), and after chemical modifications it is transformed into a four-carbon compound (malate).
  • The malate is then transported into BS chloroplasts where the decarboxylation step is performed mainly by the NADP-dependent malic enzyme (NADP-ME), leading to the release of CO2 close to the active site of the RuBisCO enzyme.
  • In C4 plants, RuBisCO is confined to BS cells, and this partitioning of carbon assimilation and carbon fixation steps greatly reduces the losses caused by photorespiration. Such an arrangement enables these plants to more efficiently use water and nitrogen, especially in hot and dry environments.

Dehydration Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Act2[1][2] Actin2
  • salinity stress
Si026509m
  • F:CGCATATGTGGCTCTTGACT
  • R: GGGCACCTAAATCTCTCTGC
126 60 SYBR
RNA POL II[1] RNA polymerase II
  • salinity stress
  • dehydration stress
Si033113m
  • F: TAGGAAAGGAATTGGCAAGG
  • R: TAGGACTGCTTTCGACCCA
146 60 SYBR
EF-1a [1] Elongation factor 1-alpha
  • dehydration stress
Si022039m
  • F:TGACTGTGCTGTCCTCATCA
  • R:GTTGCAGCAGCAAATCATCT
133 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Manoj Prasad
  • Email: manoj_prasad@nipgr.ac.in
  • Institute: National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, JNU Campus, New Delhi 110 067, India

Citation Statistics

Cited by 38 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Kumar K, Muthamilarasan M, Prasad M. Reference genes for quantitative real-time PCR analysis in the model plant foxtail millet (Setariaitalica L.) subjected to abiotic stress conditions[J]. Plant Cell, Tissue and Organ Culture (PCTOC), 2013, 115(1): 13-22.
  2. Julia Lambret-Frotté, Leandro C. S. de Almeida, Stéfanie M. de Moura, Flavio L. F. Souza, Francisco S. Validating Internal Control Genes for the Accurate Normalization of qPCR Expression Analysis of the Novel Model Plant Setaria viridis. PLoS One. 2015; 10(8): e0135006.doi: 10.1371/journal.pone.0135006. PMCID: PMC4527663.