Setaria italica

From ICG
Jump to navigation Jump to search

Description

Dehydration Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Act2[1] Actin2
  • salinity stress
Si026509m
  • F:CGCATATGTGGCTCTTGACT
  • R: GGGCACCTAAATCTCTCTGC
126 60 SYBR
RNA POL II[1] RNA polymerase II
  • salinity stress
  • dehydration stress
Si033113m
  • F: TAGGAAAGGAATTGGCAAGG
  • R: TAGGACTGCTTTCGACCCA
146 60 SYBR
EF-1a [1] Elongation factor 1-alpha
  • dehydration stress
Si022039m
  • F:TGACTGTGCTGTCCTCATCA
  • R:GTTGCAGCAGCAAATCATCT
133 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Manoj Prasad
  • Email: manoj_prasad@nipgr.ac.in
  • Institute: National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, JNU Campus, New Delhi 110 067, India

Citation Statistics

Cited by 38 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Kumar K, Muthamilarasan M, Prasad M. Reference genes for quantitative real-time PCR analysis in the model plant foxtail millet (Setariaitalica L.) subjected to abiotic stress conditions[J]. Plant Cell, Tissue and Organ Culture (PCTOC), 2013, 115(1): 13-22.