Difference between revisions of "Shiraia bambusicola"

From ICG
Jump to navigation Jump to search
 
(4 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
[[File:Shiraia bambusicola-1.jpg|right|200px|link=Shiraia bambusicola]]
 
[[File:Shiraia bambusicola-1.jpg|right|200px|link=Shiraia bambusicola]]
*'''''Shiraia bambusicola''''' is an important and valuable macrofungus in the medical and food industries. It is noteworthy for its hypocrellins, the main secondary metabolites of S. bambusicola, whose use has been proposed for disease treatments that involve anti-clinical strains and antiinflammatory and anti-viral activity.<ref name="ref1"/>
+
*'''''Shiraia bambusicola''''' is an important and valuable macrofungus in the medical and food industries. It is noteworthy for its hypocrellins, the main secondary metabolites of S. bambusicola, whose use has been proposed for disease treatments that involve anti-clinical strains and antiinflammatory and anti-viral activity <ref name="ref1"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Unknown'''
 
* <font color=blue>'''Common Name:'''</font> '''Unknown'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=224420<font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=224420<font color=blue>'''NCBI Taxonomy'''</font>]
Line 71: Line 71:
 
|}
 
|}
  
===Moleculer types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 81: Line 82:
 
*'''Name''': Cheng‑Lin Hou
 
*'''Name''': Cheng‑Lin Hou
 
*'''Email''': houchenglincn@yahoo.com
 
*'''Email''': houchenglincn@yahoo.com
*'''Institute''': College of Life Science, Capital Normal University, Beijing 100048, People’s Republic of China
+
*'''Institution''': College of Life Science, Capital Normal University, Beijing 100048, People’s Republic of China
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''??''' (Based on Google Scholar [2017-08-01])
+
Cited by [https://scholar.google.com/scholar?cites=8511595149064176514&as_sdt=2005&sciodt=0,5&hl=en '''1'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==

Latest revision as of 05:24, 1 September 2017

Description

Shiraia bambusicola-1.jpg
  • Shiraia bambusicola is an important and valuable macrofungus in the medical and food industries. It is noteworthy for its hypocrellins, the main secondary metabolites of S. bambusicola, whose use has been proposed for disease treatments that involve anti-clinical strains and antiinflammatory and anti-viral activity [1].
  • Common Name: Unknown
  • NCBI Taxonomy

Various Culture Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
SbLAlv9[1] LAlv9 family protein
  • Different light conditions
  • Different media
NA
  • F:TCCCCTCCAACAGCTCGATA
  • R:TGACGAAGCGATGCAGAAGT
159 60 SYBR
SbJsn1[1] RNA binding protein‑like protein Jsn1
  • Different light conditions
  • Different media
NA
  • F:TGCCCAGAAGATCATCGACG
  • R:ACGGCCAAGCATAACCTCAA
175 60 SYBR
SbSAS1[1] GTP‑binding protein SAS1
  • Different light conditions
  • Different media
NA
  • F:GCGATTCAGCGAAGACTCCT
  • R:ATGGTCCTGAAACGCTCCTG
141 60 SYBR
SbVAC55[1] Vacuolar protein sorting 55
  • Different light conditions
  • Different media
NA
  • F:GGCTGTCTTTCGTTCTTGCG
  • R:AAGTCATCCCGGTTAGCTGC
151 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Cheng‑Lin Hou
  • Email: houchenglincn@yahoo.com
  • Institution: College of Life Science, Capital Normal University, Beijing 100048, People’s Republic of China

Citation Statistics

Cited by 1 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Zhang C, Li T, Hou CL, Shen XY. Selection of reference genes from Shiraia bambusicola for RT-qPCR analysis under different culturing conditions. AMB Express. 2017 Dec;7(1):14. doi: 10.1186/s13568-016-0314-9. Epub 2017 Jan 3. PubMed PMID: 28050855; PubMed Central PMCID: PMC5209326.

Categories