Shiraia bambusicola

From ICG
Jump to navigation Jump to search

Description

Shiraia bambusicola-1.jpg
  • Shiraia bambusicola is an important and valuable macrofungus in the medical and food industries.
  • It is noteworthy for its hypocrellins, the main secondary metabolites of S. bambusicola, whose use has been proposed for disease treatments that involve anti-clinical strains and antiinflammatory and anti-viral activity.[1]
  • Common Name: Unknown
  • NCBI Taxonomy

Various Culture Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
SbLAlv9[1] LAlv9 family protein
  • Different light conditions
  • Different media
NA
  • F:TCCCCTCCAACAGCTCGATA
  • R:TGACGAAGCGATGCAGAAGT
159 60 SYBR
SbJsn1[1] RNA binding protein‑like protein Jsn1
  • Different light conditions
  • Different media
NA
  • F:TGCCCAGAAGATCATCGACG
  • R:ACGGCCAAGCATAACCTCAA
175 60 SYBR
SbSAS1[1] GTP‑binding protein SAS1
  • Different light conditions
  • Different media
NA
  • F:GCGATTCAGCGAAGACTCCT
  • R:ATGGTCCTGAAACGCTCCTG
141 60 SYBR
SbVAC55[1] Vacuolar protein sorting 55
  • Different light conditions
  • Different media
NA
  • F:GGCTGTCTTTCGTTCTTGCG
  • R:AAGTCATCCCGGTTAGCTGC
151 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Cheng‑Lin Hou
  • Email: houchenglincn@yahoo.com
  • Institute: College of Life Science, Capital Normal University, Beijing 100048, People’s Republic of China

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Zhang C, Li T, Hou CL, Shen XY. Selection of reference genes from Shiraia bambusicola for RT-qPCR analysis under different culturing conditions. AMB Express. 2017 Dec;7(1):14. doi: 10.1186/s13568-016-0314-9. Epub 2017 Jan 3. PubMed PMID: 28050855; PubMed Central PMCID: PMC5209326.

Categories