Solanum lycopersicum

Description

Solanum lycopersicum is commonly known as a tomato plant, which belongs to the nightshade Solanaceae family. It is originated in Central and South America. The domestication of the tomato and associated selective pressures eventually led to the large-fruited varieties cultivated today. Varieties display considerable variance in fruit colour intensity, shape, and quality^[1]^[2].
Common Name: Tomato
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
GAPDH^[1]	Glyceraldehyde 3-phosphate dehydrogenase	Leaf and root tissues subjected to infection of viruses and a viroid	U93208	F:ACCACAAATTGCCTTGCTCCCTTG R:ATCAACGGTCTTCTGAGTGGCTGT	110	60	SYBR
UBI^[1]	Ubiquitin	Leaf and root tissues subjected to infection of viruses and a viroid	X58253	F:TCGTAAGGAGTGCCCTAATGCTGA R:CAATCGCCTCCAGCCTTGTTGTAA	119	60	SYBR
ACT^[1]	Actin	Leaf and root tissues subjected to infection of viruses and a viroid	BT013707	F:AGGCAGGATTTGCTGGTGATGATGCT R:ATACGCATCCTTCTGTCCCATTCCGA	107	60	SYBR
UK^[1]	Uridylate kinase	Leaf and root tissues subjected to infection of viruses and a viroid	AK322232	F:TGGTAAGGGCACCCAATGTGCTAA R:ATCATCGTCCCATTCTCGGAACCA	114	60	SYBR
CyP^[1]	Cyclophilin (peptidyl-prolylcis–trans isomerase)	Root samples	AK326854	F:CTCTTCGCCGATACCACTCC R:TCACACGGTGGAAGGTTGAG	120	60	SYBR

Name: FABRIZIO CILLO
Email: f.cillo@ba.ivv.cnr.it
Institution: Istituto di Virologia Vegetale, CNR, Via Amendola 165/A, 70126 Bari, Italy

Cited by 64 (Based on Google Scholar [2017-08-10])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 Mascia T, Santovito E, Gallitelli D, et al. Evaluation of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in infected tomato plants[J]. Molecular plant pathology, 2010, 11(6): 805-816.
↑ Nicolas Schauer, Dani Zamir, Alisdair R. Fernie; Metabolic profiling of leaves and fruit of wild species tomato: a survey of the Solanum lycopersicum complex. J Exp Bot 2005; 56 (410): 297-307. doi: 10.1093/jxb/eri057