Difference between revisions of "Solanum tuberosum"

From ICG
Jump to navigation Jump to search
 
(20 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
  
[[File:Solanum tuberosum-1.jpg|right|227px|]]
+
[[File:Solanum tuberosum.png|right|200px|link=Solanum tuberosum]]
* '''''Potato (Solanum tuberosum L.)''''' is a member of the Solanaceae, an economically important family that includes tomato, pepper, aubergine (eggplant), petunia and tobacco. Potato belongs to the asterid clade of eudicot plants that represents ,25% of flowering plant species and from which a complete genome sequence has not yet, to our knowledge, been published. Potato occupies a wide eco-geographical range and is unique among the major world food crops in producing stolons (underground stems) that under suitable environmental conditions swell to form tubers.
+
* '''''Solanum tuberosum L.''''' is a an economically important species of the Solanaceae. It occupies a wide eco-geographical range and is unique among the major world food crops in producing stolons (underground stems) that under suitable environmental conditions swell to form tubers. The tubers are a globally important dietary source of starch, protein, antioxidants and vitamins, serving the plant as both a storage organ and a vegetative propagation system<ref name="ref1"/><ref name="ref2"/>.
* Its worldwide importance, especially within the developing world, is growing rapidly. The tubers are a globally important dietary source of starch, protein, antioxidants and vitamins, serving the plant as both a storage organ and a vegetative propagation system. Despite the importance of tubers, the evolutionary and developmental mechanisms of their initiation and growth remain elusive.<ref name="ref1"/> <ref name="ref2"/>.
 
 
* <font color=blue>'''Common Name:'''</font> '''Potato'''
 
* <font color=blue>'''Common Name:'''</font> '''Potato'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4113 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4113 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Cold Stress'''''==
 
=='''''Cold Stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 23: Line 22:
 
|align="center"| Elongation factor 1-a
 
|align="center"| Elongation factor 1-a
 
|
 
|
* Universal reference gene
+
* Tuber tissues
 +
* Cold storage at different temperatures and treatment periods
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB061263 '''AB061263''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/AB061263 '''AB061263''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 32: Line 32:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|-
 
|-
|align="center"| APRT<ref name="ref1"/>
+
|align="center"| APT<ref name="ref1"/>
 
|align="center"| Adenine phosphoribosyl transferase
 
|align="center"| Adenine phosphoribosyl transferase
 
|
 
|
* Universal reference gene
+
* Tuber tissues
 +
* Cold storage at different temperatures and treatment periods
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CK270447 '''CK270447''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/CK270447 '''CK270447''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 57: Line 58:
 
*'''Institution''': The Basque Institute of Agricultural Research and Development, PO Box 46, E01080 Vitoria, Spain
 
*'''Institution''': The Basque Institute of Agricultural Research and Development, PO Box 46, E01080 Vitoria, Spain
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''22''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=16751919841823921765&as_sdt=2005&sciodt=0,5&hl=en'''22'''] (Based on Google Scholar [2017-09-01])
 +
 
 +
=='''''Parasitic Infection '''''==
 +
===Internal Control Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25% font-size:9pt "|Application Scope
 +
! Accession Number
 +
! Primers (5'-3')<br>[Forward/Reverse]
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| RPN7<ref name="ref3"/>
 +
|align="center"| 26S proteasome regulatory subunit
 +
|
 +
*Roots Infected with Cyst Nematodes
 +
|align="center"| TC203637(TGI potato TC number)
 +
|nowrap style="font-size:9pt"|
 +
* F:TTGGGGTGTCTGAGGATTTC
 +
* R:CATTCTTTGCATCAGGACGA
 +
|align="center"| 123
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| UBP22<ref name="ref3"/>
 +
|align="center"| ubiquitin-specific protease 22
 +
|
 +
*Roots Infected with Cyst Nematodes
 +
|align="center"| TC212444(TGI potato TC number)
 +
|nowrap style="font-size:9pt"|
 +
* F:CAATGCAGCAACGCCAGA
 +
* R:AGCAGCAGTAGCACCACCAC
 +
|align="center"| 98
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| OXA1<ref name="ref3"/>
 +
|align="center"| OXA1 protein
 +
|
 +
*Roots Infected with Cyst Nematodes
 +
|align="center"| TC204983(TGI potato TC number)
 +
|nowrap style="font-size:9pt"|
 +
* F:GCGATTCTGAAGCCAAAACT
 +
* R:TTGTTGACCTTCAGCCACAG
 +
|align="center"| 87
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| MST2<ref name="ref3"/>
 +
|align="center"| mercaptopyruvate sulfurtransferase
 +
|
 +
*Roots Infected with Cyst Nematodes
 +
|align="center"| TC206257(TGI potato TC number)
 +
|nowrap style="font-size:9pt"|
 +
* F:AGTGCAGCTCGTGTATGGTG
 +
* R:ATCCAGAAGCACGCCATCT
 +
|align="center"| 94
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|}
 +
 
 +
===Molecular Types===
 +
* mRNA
 +
 
 +
===Evaluation Methods===
 +
*  '''Ref-Finder method''' && [https://www.ncbi.nlm.nih.gov/pubmed/22290409 '''Related Reference''']
 +
===Contact===
 +
*'''Name''': Bernard Caromel
 +
*'''Email''': Bernard.Caromel@avignon.inra.fr
 +
*'''Institution''': INRA, UR1052 GAFL Génétique et Amélioration des Fruits et Légumes, Domaine Saint Maurice, Allée des Chênes, CS 60094, 84143 Montfavet Cedex, France
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=15978231869016817235&as_sdt=2005&sciodt=0,5&hl=en'''10'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 66: Line 141:
 
<ref name="ref2">
 
<ref name="ref2">
 
Hijmans, R. J. Global distribution of the potato crop. Am. J. Potato Res. 78, 403–412 (2001).
 
Hijmans, R. J. Global distribution of the potato crop. Am. J. Potato Res. 78, 403–412 (2001).
 +
</ref>
 +
<ref name="ref3">
 +
Castro-Quezada, Patricio, et al. "Identification of reference genes for normalizing RNA expression in potato roots infected with cyst nematodes." Plant molecular biology reporter 31.4 (2013): 936-945.
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]] [[Category:mRNA]] [[Category:SYBR]]
+
 
[[Category:APT]] [[Category:EF1α]]
+
=='''Categories'''==
[[Category:Cold Treatment]]
+
[[Category:Plants]][[Category:mRNA]] [[Category:SYBR]][[Category:APT]][[Category:EF1α]][[Category:Cold Treatment]][[Category:RPN7]][[Category:Ubiquitin]][[Category:OXA1]] [[Category:MST2]][[Category:geNorm]][[Category:NormFinder]][[Category:BestKeeper]][[Category:RefFinder]]

Latest revision as of 07:55, 1 September 2017

Description

Solanum tuberosum.png
  • Solanum tuberosum L. is a an economically important species of the Solanaceae. It occupies a wide eco-geographical range and is unique among the major world food crops in producing stolons (underground stems) that under suitable environmental conditions swell to form tubers. The tubers are a globally important dietary source of starch, protein, antioxidants and vitamins, serving the plant as both a storage organ and a vegetative propagation system[1][2].
  • Common Name: Potato
  • NCBI Taxonomy

Cold Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ef1a[1] Elongation factor 1-a
  • Tuber tissues
  • Cold storage at different temperatures and treatment periods
AB061263
  • F:ATTGGAAACGGATATGCTCCA
  • R:TCCTTACCTGAACGCCTGTCA
101 60 SYBR
APT[1] Adenine phosphoribosyl transferase
  • Tuber tissues
  • Cold storage at different temperatures and treatment periods
CK270447
  • F:GAACCGGAGCAGGTGAAGAA
  • R:GAAGCAATCCCAGCGATACG
121 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jose Ignacio Ruiz de Galarreta
  • Email: jiruiz@neiker.net
  • Institution: The Basque Institute of Agricultural Research and Development, PO Box 46, E01080 Vitoria, Spain

Citation Statistics

Cited by 22 (Based on Google Scholar [2017-09-01])

Parasitic Infection

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPN7[3] 26S proteasome regulatory subunit
  • Roots Infected with Cyst Nematodes
TC203637(TGI potato TC number)
  • F:TTGGGGTGTCTGAGGATTTC
  • R:CATTCTTTGCATCAGGACGA
123 60 SYBR
UBP22[3] ubiquitin-specific protease 22
  • Roots Infected with Cyst Nematodes
TC212444(TGI potato TC number)
  • F:CAATGCAGCAACGCCAGA
  • R:AGCAGCAGTAGCACCACCAC
98 60 SYBR
OXA1[3] OXA1 protein
  • Roots Infected with Cyst Nematodes
TC204983(TGI potato TC number)
  • F:GCGATTCTGAAGCCAAAACT
  • R:TTGTTGACCTTCAGCCACAG
87 60 SYBR
MST2[3] mercaptopyruvate sulfurtransferase
  • Roots Infected with Cyst Nematodes
TC206257(TGI potato TC number)
  • F:AGTGCAGCTCGTGTATGGTG
  • R:ATCCAGAAGCACGCCATCT
94 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Bernard Caromel
  • Email: Bernard.Caromel@avignon.inra.fr
  • Institution: INRA, UR1052 GAFL Génétique et Amélioration des Fruits et Légumes, Domaine Saint Maurice, Allée des Chênes, CS 60094, 84143 Montfavet Cedex, France

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Lopez-Pardo R, de Galarreta J I R, Ritter E. Selection of housekeeping genes for qRT-PCR analysis in potato tubers under cold stress[J]. Molecular breeding, 2013, 31(1): 39-45.
  2. Hijmans, R. J. Global distribution of the potato crop. Am. J. Potato Res. 78, 403–412 (2001).
  3. 3.0 3.1 3.2 3.3 Castro-Quezada, Patricio, et al. "Identification of reference genes for normalizing RNA expression in potato roots infected with cyst nematodes." Plant molecular biology reporter 31.4 (2013): 936-945.

Categories