Solanum tuberosum

From ICG
Jump to navigation Jump to search

Description

Solanum tuberosum.png
  • Potato (Solanum tuberosum L.) is a member of the Solanaceae, an economically important family that includes tomato, pepper, aubergine (eggplant), petunia and tobacco. Potato belongs to the asterid clade of eudicot plants that represents ,25% of flowering plant species and from which a complete genome sequence has not yet, to our knowledge, been published. Potato occupies a wide eco-geographical range and is unique among the major world food crops in producing stolons (underground stems) that under suitable environmental conditions swell to form tubers.
  • Its worldwide importance, especially within the developing world, is growing rapidly. The tubers are a globally important dietary source of starch, protein, antioxidants and vitamins, serving the plant as both a storage organ and a vegetative propagation system. Despite the importance of tubers, the evolutionary and developmental mechanisms of their initiation and growth remain elusive.[1] [2].
  • Common Name: Potato
  • NCBI Taxonomy

Cold Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
ef1a[1] Elongation factor 1-a
  • Universal reference gene
AB061263
  • F:ATTGGAAACGGATATGCTCCA
  • R:TCCTTACCTGAACGCCTGTCA
101 60 SYBR
APRT[1] Adenine phosphoribosyl transferase
  • Universal reference gene
CK270447
  • F:GAACCGGAGCAGGTGAAGAA
  • R:GAAGCAATCCCAGCGATACG
121 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jose Ignacio Ruiz de Galarreta
  • Email: jiruiz@neiker.net
  • Institution: The Basque Institute of Agricultural Research and Development, PO Box 46, E01080 Vitoria, Spain

Citation Statistics

Cited by 22 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Lopez-Pardo R, de Galarreta J I R, Ritter E. Selection of housekeeping genes for qRT-PCR analysis in potato tubers under cold stress[J]. Molecular breeding, 2013, 31(1): 39-45.
  2. Hijmans, R. J. Global distribution of the potato crop. Am. J. Potato Res. 78, 403–412 (2001).