Solanum tuberosum

Description

Potato (Solanum tuberosum L.) is a member of the Solanaceae, an economically important family that includes tomato, pepper, aubergine (eggplant), petunia and tobacco. Potato belongs to the asterid clade of eudicot plants that represents ,25% of flowering plant species and from which a complete genome sequence has not yet, to our knowledge, been published. Potato occupies a wide eco-geographical range and is unique among the major world food crops in producing stolons (underground stems) that under suitable environmental conditions swell to form tubers.
Its worldwide importance, especially within the developing world, is growing rapidly. The tubers are a globally important dietary source of starch, protein, antioxidants and vitamins, serving the plant as both a storage organ and a vegetative propagation system. Despite the importance of tubers, the evolutionary and developmental mechanisms of their initiation and growth remain elusive.^[1] ^[2].
Common Name: Potato
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
ef1a^[1]	Elongation factor 1-a	Universal reference gene	AB061263	F:ATTGGAAACGGATATGCTCCA R:TCCTTACCTGAACGCCTGTCA	101	60	SYBR
APRT^[1]	Adenine phosphoribosyl transferase	Universal reference gene	CK270447	F:GAACCGGAGCAGGTGAAGAA R:GAAGCAATCCCAGCGATACG	121	60	SYBR

Name: Jose Ignacio Ruiz de Galarreta
Email: jiruiz@neiker.net
Institution: The Basque Institute of Agricultural Research and Development, PO Box 46, E01080 Vitoria, Spain

Cited by 22 (Based on Google Scholar [2017-06-16])

↑ ^1.0 ^1.1 ^1.2 Lopez-Pardo R, de Galarreta J I R, Ritter E. Selection of housekeeping genes for qRT-PCR analysis in potato tubers under cold stress[J]. Molecular breeding, 2013, 31(1): 39-45.
↑ Hijmans, R. J. Global distribution of the potato crop. Am. J. Potato Res. 78, 403–412 (2001).