Difference between revisions of "Sorghum bicolor"

From ICG
Jump to navigation Jump to search
 
(19 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2017006-1.jpg|right|227px|]]
+
[[File:Sorghum bicolor.png|right|200px|link=Sorghum bicolor]]
* Sorghum is a yearly herb in the grasses. The stalks are thick, upright and support roots in the base section. A scabbard without hair or a bit of white powder; The epiglossia, the first round, the edge of the cilia. Sex is warm, drought-resistant and waterlogged. It can be divided into edible sorghum, sugar sorghum, and brush with sorghum.
+
* '''''Sorghum bicolor''''', an African grass related to sugar cane and maize, is grown for food, feed, fibre and fuel. Sorghum is a yearly herb in the grasses. The stalks are thick, upright and support roots in the base section. It can be divided into edible sorghum, sugar sorghum, and brush with sorghum. It is more widely cultivated in China, with the largest number of regions in the northeast. Edible sorghum grain is used for consumption and mading wine and the stalks is to make syrup or raw food.<ref name="ref1"/> <ref name="ref2"/>.
* China is more widely cultivated, with the largest number of regions in the northeast. Edible sorghum grain for consumption and wine. The use of sorghum stalks to make syrup or raw food; A broom or a cooking brush with a grain of sorghum. The tender leaves are dried and silvery, or dried and can be used as fodder. Yingguo can take the medicine, can dry wet expectoration, ningxin is the god.
+
* <font color=blue>'''Common Name:'''</font> '''Sorghum'''
* Sorghum, an African grass related to sugar cane and maize, is grown for food, feed, fibre and fuel.<ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4558 <font color=blue>'''NCBI Taxonomy'''</font>]
=='''''Different Tissues & Abiotic Stress Treatments '''''==
+
 
===Reference Genes===
+
=='''''Different Tissues & Abiotic Stress'''''==
 +
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 12: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 20: Line 21:
 
|align="center"| Serine/threonine-Protein
 
|align="center"| Serine/threonine-Protein
 
|
 
|
* Universal reference gene
+
* Salt, cold, water stress, heat, and abscisic acid
 +
* Leaves, roots, seedlings, panicle, and mature seeds
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002453490 '''XM_002453490''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002453490 '''XM_002453490''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:AACCCGCAAAACCCCAGACTA
 
* F:AACCCGCAAAACCCCAGACTA
* R:AACCCGCAAAACCCCAGACTA
+
* R:TACAGGTCGGGCTCATGGAAC
 
|align="center"|  138  
 
|align="center"|  138  
 
|align="center"| 82.7
 
|align="center"| 82.7
Line 32: Line 34:
 
|align="center"| Eukaryotic Initiation Factor 4A
 
|align="center"| Eukaryotic Initiation Factor 4A
 
|
 
|
* Different tissue samples
+
* Salt, cold, water stress, heat, and abscisic acid
 +
* Leaves, roots, seedlings, panicle, and mature seeds
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002451491 '''XM_00245149''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002451491 '''XM_00245149''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CAACTTTGTCACCCGCGATGA
 
* F:CAACTTTGTCACCCGCGATGA
* R:CAACTTTGTCACCCGCGATGA
+
* R:TCCAGAAACCTTAGCAGCCCA
 
|align="center"|  144  
 
|align="center"|  144  
 
|align="center"| 84.8
 
|align="center"| 84.8
Line 42: Line 45:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 
===Evaluation Methods===  
 
===Evaluation Methods===  
Line 54: Line 57:
 
*'''Institution''': International Crops Research Institute for the Semi-Arid Tropics, Patancheru, India
 
*'''Institution''': International Crops Research Institute for the Semi-Arid Tropics, Patancheru, India
  
==Citation Statistics==
+
===Citation Statistics===
Cited by '''1808''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=12739656277794973309&as_sdt=2005&sciodt=0,5&hl=en'''7'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
Paterson AH, Bowers JE, Bruggmann R, et al. (2009) The Sorghum bicolor genome and the diversification of grasses. Nature 457, 551-556.
+
Sudhakar Reddy P, Srinivas Reddy D, Sivasakthi K, et al. (2016) Evaluation of Sorghum [Sorghum bicolor (L.)] Reference Genes in Various Tissues and under Abiotic Stress Conditions for Quantitative Real-Time PCR Data Normalization. Front Plant Sci 7, 529.
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
Sudhakar Reddy P, Srinivas Reddy D, Sivasakthi K, et al. (2016) Evaluation of Sorghum [Sorghum bicolor (L.)] Reference Genes in Various Tissues and under Abiotic Stress Conditions for Quantitative Real-Time PCR Data Normalization. Front Plant Sci 7, 529.
+
Paterson AH, Bowers JE, Bruggmann R, et al. (2009) The Sorghum bicolor genome and the diversification of grasses. Nature 457, 551-556.
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
[[Category:Plants]]
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:eIF]][[Category:PP2A]][[Category:Different Tissues]][[Category:Abiotic Stress]][[Category:geNorm]] [[Category:NormFinder]][[Category:BestKeeper]]
[[Category:mRNA]] 
 
[[Category:SYBR]]
 

Latest revision as of 07:57, 1 September 2017

Description

Sorghum bicolor.png
  • Sorghum bicolor, an African grass related to sugar cane and maize, is grown for food, feed, fibre and fuel. Sorghum is a yearly herb in the grasses. The stalks are thick, upright and support roots in the base section. It can be divided into edible sorghum, sugar sorghum, and brush with sorghum. It is more widely cultivated in China, with the largest number of regions in the northeast. Edible sorghum grain is used for consumption and mading wine and the stalks is to make syrup or raw food.[1] [2].
  • Common Name: Sorghum
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PP2A[1] Serine/threonine-Protein
  • Salt, cold, water stress, heat, and abscisic acid
  • Leaves, roots, seedlings, panicle, and mature seeds
XM_002453490
  • F:AACCCGCAAAACCCCAGACTA
  • R:TACAGGTCGGGCTCATGGAAC
138 82.7 SYBR
EIF4α[1] Eukaryotic Initiation Factor 4A
  • Salt, cold, water stress, heat, and abscisic acid
  • Leaves, roots, seedlings, panicle, and mature seeds
XM_00245149
  • F:CAACTTTGTCACCCGCGATGA
  • R:TCCAGAAACCTTAGCAGCCCA
144 84.8 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Palakolanu Sudhakar Reddy
  • Email: p.sudhakarreddy@cgiar.org
  • Institution: International Crops Research Institute for the Semi-Arid Tropics, Patancheru, India

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Sudhakar Reddy P, Srinivas Reddy D, Sivasakthi K, et al. (2016) Evaluation of Sorghum [Sorghum bicolor (L.)] Reference Genes in Various Tissues and under Abiotic Stress Conditions for Quantitative Real-Time PCR Data Normalization. Front Plant Sci 7, 529.
  2. Paterson AH, Bowers JE, Bruggmann R, et al. (2009) The Sorghum bicolor genome and the diversification of grasses. Nature 457, 551-556.

Categories