Difference between revisions of "Sorghum bicolor"

From ICG
Jump to navigation Jump to search
Line 70: Line 70:
 
[[Category:mRNA]]   
 
[[Category:mRNA]]   
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 +
[[Category:eIF]] [[Category:PP2A]]

Revision as of 08:59, 19 June 2017

Description

REFqPCR2017006-1.jpg
  • Sorghum is a yearly herb in the grasses. The stalks are thick, upright and support roots in the base section. A scabbard without hair or a bit of white powder; The epiglossia, the first round, the edge of the cilia. Sex is warm, drought-resistant and waterlogged. It can be divided into edible sorghum, sugar sorghum, and brush with sorghum.
  • China is more widely cultivated, with the largest number of regions in the northeast. Edible sorghum grain for consumption and wine. The use of sorghum stalks to make syrup or raw food; A broom or a cooking brush with a grain of sorghum. The tender leaves are dried and silvery, or dried and can be used as fodder. Yingguo can take the medicine, can dry wet expectoration, ningxin is the god.
  • Sorghum, an African grass related to sugar cane and maize, is grown for food, feed, fibre and fuel.[1] [2].

Different Tissues & Abiotic Stress Treatments

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
PP2A[1] Serine/threonine-Protein
  • Universal reference gene
XM_002453490
  • F:AACCCGCAAAACCCCAGACTA
  • R:AACCCGCAAAACCCCAGACTA
138 82.7 SYBR
EIF4α[1] Eukaryotic Initiation Factor 4A
  • Different tissue samples
XM_00245149
  • F:CAACTTTGTCACCCGCGATGA
  • R:CAACTTTGTCACCCGCGATGA
144 84.8 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Palakolanu Sudhakar Reddy
  • Email: p.sudhakarreddy@cgiar.org
  • Institution: International Crops Research Institute for the Semi-Arid Tropics, Patancheru, India

Citation Statistics

Cited by 1808 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 Paterson AH, Bowers JE, Bruggmann R, et al. (2009) The Sorghum bicolor genome and the diversification of grasses. Nature 457, 551-556.
  2. Sudhakar Reddy P, Srinivas Reddy D, Sivasakthi K, et al. (2016) Evaluation of Sorghum [Sorghum bicolor (L.)] Reference Genes in Various Tissues and under Abiotic Stress Conditions for Quantitative Real-Time PCR Data Normalization. Front Plant Sci 7, 529.