All public logs
Jump to navigation
Jump to search
Combined display of all available logs of ICG. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).
(newest | oldest) View (newer 20 | older 20) (20 | 50 | 100 | 250 | 500)- 16:07, 3 February 2021 Xysj2012 talk contribs deleted page Спорт Спорт Новости Спортивные Новости Sport Sporting Sport Sport Новости Спорта (content was: "спортивное снаряжение это специальные предметы, необходимые для...", and the only contributor was "HungSnider92" (talk))
- 11:46, 3 February 2021 User account 192.168.164.109 talk was created
- 11:20, 3 February 2021 192.168.164.109 talk created page Спорт Спорт Новости Спортивные Новости Sport Sporting Sport Sport Новости Спорта (Created page with "спортивное снаряжение это специальные предметы, необходимые для занятий физической культурой...")
- 11:20, 3 February 2021 192.168.164.109 talk created page User:HungSnider92 (Created page with "спортивное снаряжение это специальные предметы, предназначенные для занятий спортом [https://mr-sport...")
- 11:20, 3 February 2021 User account 192.168.164.109 talk was created
- 01:37, 21 August 2017 Xysj2012 talk contribs deleted page Test3 (content was: "{{DNA| SOURCE = human eif | DNA = ACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGTCCACACCC GCCGCCAGCTCACCATGGATGATGAT...", and the only contributor was "Xysj2012" (talk))
- 14:10, 20 August 2017 Xysj2012 talk contribs deleted page Test2 (content was: "<html> <iframe frameborder=0 width=1000 height=300 marginheight=0 marginwidth=0 scrolling=yes src=http://192.168.72.232/00-Test/ICG...", and the only contributor was "Xysj2012" (talk))
- 08:58, 15 August 2017 Xysj2012 talk contribs deleted page BLAST (content was: " {|class="wikitable sortable" style="font-size:12pt; width:100%" |- ! Literature ! Species ! Publication Year |- | *Validation...", and the only contributor was "Xysj2012" (talk))
- 12:48, 13 August 2017 Xysj2012 talk contribs deleted page Test6 (content was: "<html> <iframe frameborder=0 width=1000 height=680 marginheight=0 marginwidth=0 scrolling=yes src=http://127.0.0.1/00-Test/phpweb/0...", and the only contributor was "Xysj2012" (talk))
- 12:41, 13 August 2017 Xysj2012 talk contribs uploaded a new version of File:Species.png
- 03:33, 13 August 2017 Xysj2012 talk contribs uploaded a new version of File:Gene Ontology 1.png
- 03:33, 13 August 2017 Xysj2012 talk contribs uploaded a new version of File:Experiment Ontology 1.png
- 03:30, 13 August 2017 Xysj2012 talk contribs uploaded File:Experiment Ontology 1.png
- 03:28, 13 August 2017 Xysj2012 talk contribs uploaded File:Gene Ontology 1.png
- 03:04, 13 August 2017 Xysj2012 talk contribs uploaded File:Species 1.png
- 11:54, 12 August 2017 Xysj2012 talk contribs uploaded File:Species.png
- 10:41, 12 August 2017 Xysj2012 talk contribs uploaded a new version of File:Gene Ontology.png
- 10:40, 12 August 2017 Xysj2012 talk contribs uploaded a new version of File:Experiment Ontology.png
- 10:37, 12 August 2017 Xysj2012 talk contribs uploaded File:Experiment Ontology.png
- 10:36, 12 August 2017 Xysj2012 talk contribs uploaded File:Gene Ontology.png