All public logs
Jump to navigation
Jump to search
Combined display of all available logs of ICG. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).
(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)- 16:07, 3 February 2021 Xysj2012 talk contribs deleted page Спорт Спорт Новости Спортивные Новости Sport Sporting Sport Sport Новости Спорта (content was: "спортивное снаряжение это специальные предметы, необходимые для...", and the only contributor was "HungSnider92" (talk))
- 11:46, 3 February 2021 User account 192.168.164.109 talk was created
- 11:20, 3 February 2021 192.168.164.109 talk created page Спорт Спорт Новости Спортивные Новости Sport Sporting Sport Sport Новости Спорта (Created page with "спортивное снаряжение это специальные предметы, необходимые для занятий физической культурой...")
- 11:20, 3 February 2021 192.168.164.109 talk created page User:HungSnider92 (Created page with "спортивное снаряжение это специальные предметы, предназначенные для занятий спортом [https://mr-sport...")
- 11:20, 3 February 2021 User account 192.168.164.109 talk was created
- 01:37, 21 August 2017 Xysj2012 talk contribs deleted page Test3 (content was: "{{DNA| SOURCE = human eif | DNA = ACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGTCCACACCC GCCGCCAGCTCACCATGGATGATGAT...", and the only contributor was "Xysj2012" (talk))
- 14:10, 20 August 2017 Xysj2012 talk contribs deleted page Test2 (content was: "<html> <iframe frameborder=0 width=1000 height=300 marginheight=0 marginwidth=0 scrolling=yes src=http://192.168.72.232/00-Test/ICG...", and the only contributor was "Xysj2012" (talk))
- 08:58, 15 August 2017 Xysj2012 talk contribs deleted page BLAST (content was: " {|class="wikitable sortable" style="font-size:12pt; width:100%" |- ! Literature ! Species ! Publication Year |- | *Validation...", and the only contributor was "Xysj2012" (talk))
- 12:48, 13 August 2017 Xysj2012 talk contribs deleted page Test6 (content was: "<html> <iframe frameborder=0 width=1000 height=680 marginheight=0 marginwidth=0 scrolling=yes src=http://127.0.0.1/00-Test/phpweb/0...", and the only contributor was "Xysj2012" (talk))
- 12:41, 13 August 2017 Xysj2012 talk contribs uploaded a new version of File:Species.png
- 03:33, 13 August 2017 Xysj2012 talk contribs uploaded a new version of File:Gene Ontology 1.png
- 03:33, 13 August 2017 Xysj2012 talk contribs uploaded a new version of File:Experiment Ontology 1.png
- 03:30, 13 August 2017 Xysj2012 talk contribs uploaded File:Experiment Ontology 1.png
- 03:28, 13 August 2017 Xysj2012 talk contribs uploaded File:Gene Ontology 1.png
- 03:04, 13 August 2017 Xysj2012 talk contribs uploaded File:Species 1.png
- 11:54, 12 August 2017 Xysj2012 talk contribs uploaded File:Species.png
- 10:41, 12 August 2017 Xysj2012 talk contribs uploaded a new version of File:Gene Ontology.png
- 10:40, 12 August 2017 Xysj2012 talk contribs uploaded a new version of File:Experiment Ontology.png
- 10:37, 12 August 2017 Xysj2012 talk contribs uploaded File:Experiment Ontology.png
- 10:36, 12 August 2017 Xysj2012 talk contribs uploaded File:Gene Ontology.png
- 08:26, 12 August 2017 Xysj2012 talk contribs deleted page Category:RPSA (content was: "*RPSA", and the only contributor was "ICG Expert4" (talk))
- 10:57, 11 August 2017 Xysj2012 talk contribs uploaded File:Eif 1.png
- 06:44, 11 August 2017 Xysj2012 talk contribs deleted page Gene:RPSA (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous ! Application scenarios ! Publication ! Year |} =='''''Externa...")
- 06:33, 11 August 2017 Xysj2012 talk contribs uploaded File:RPL.png
- 04:20, 11 August 2017 Xysj2012 talk contribs uploaded File:AP1.png
- 04:18, 11 August 2017 Xysj2012 talk contribs uploaded a new version of File:AP.png
- 04:18, 11 August 2017 Xysj2012 talk contribs deleted page File:AP.png (Deleted old revision 20170811041821!AP.png)
- 04:18, 11 August 2017 Xysj2012 talk contribs uploaded a new version of File:AP.png
- 02:23, 11 August 2017 Xysj2012 talk contribs deleted page Category:MiRNA (content was: "* miRNA")
- 01:15, 11 August 2017 Wangzhennan talk contribs uploaded File:SF.png
- 14:07, 10 August 2017 Xysj2012 talk contribs deleted page Category:SF3A1 (content was: "*SF3A1", and the only contributor was "ICG Expert4" (talk))
- 14:04, 10 August 2017 Xysj2012 talk contribs deleted page Category:EF2 (content was: "*EF2", and the only contributor was "ICG Expert4" (talk))
- 14:02, 10 August 2017 Xysj2012 talk contribs deleted page Category:U2AF (content was: "*U2AF", and the only contributor was "ICG Expert4" (talk))
- 14:01, 10 August 2017 Xysj2012 talk contribs deleted page Category:EF4 (content was: "*TPC2L", and the only contributor was "ICG Expert4" (talk))
- 10:40, 10 August 2017 Xysj2012 talk contribs uploaded File:ARM.png
- 08:23, 10 August 2017 Wangzhennan talk contribs uploaded File:GyrA.png
- 08:08, 10 August 2017 Wangzhennan talk contribs uploaded File:B2M.png
- 07:59, 10 August 2017 Wangzhennan talk contribs uploaded File:PEPKR.png
- 07:52, 10 August 2017 Wangzhennan talk contribs uploaded File:ARP.png
- 07:47, 10 August 2017 Wangzhennan talk contribs uploaded File:SAM.png
- 07:32, 10 August 2017 Wangzhennan talk contribs uploaded File:PTB.png
- 07:25, 10 August 2017 Wangzhennan talk contribs uploaded File:GUSB.png
- 07:11, 10 August 2017 Wangzhennan talk contribs uploaded File:Rer1.png
- 07:01, 10 August 2017 Wangzhennan talk contribs uploaded File:IDE.png
- 06:49, 10 August 2017 Wangzhennan talk contribs uploaded File:SOD.png
- 03:59, 10 August 2017 Wangzhennan talk contribs uploaded File:Ep.png
- 03:46, 10 August 2017 Wangzhennan talk contribs uploaded File:SKIP.png
- 03:33, 10 August 2017 Wangzhennan talk contribs uploaded File:HK.png
- 03:19, 10 August 2017 Wangzhennan talk contribs uploaded File:ABCT.png
- 03:12, 10 August 2017 Wangzhennan talk contribs uploaded File:HSP90.png
