All public logs
Jump to navigation
Jump to search
Combined display of all available logs of ICG. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).
- 16:07, 3 February 2021 Xysj2012 talk contribs deleted page Спорт Спорт Новости Спортивные Новости Sport Sporting Sport Sport Новости Спорта (content was: "спортивное снаряжение это специальные предметы, необходимые для...", and the only contributor was "HungSnider92" (talk))
- 01:37, 21 August 2017 Xysj2012 talk contribs deleted page Test3 (content was: "{{DNA| SOURCE = human eif | DNA = ACCGCCGAGACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGTCCACACCC GCCGCCAGCTCACCATGGATGATGAT...", and the only contributor was "Xysj2012" (talk))
- 14:10, 20 August 2017 Xysj2012 talk contribs deleted page Test2 (content was: "<html> <iframe frameborder=0 width=1000 height=300 marginheight=0 marginwidth=0 scrolling=yes src=http://192.168.72.232/00-Test/ICG...", and the only contributor was "Xysj2012" (talk))
- 08:58, 15 August 2017 Xysj2012 talk contribs deleted page BLAST (content was: " {|class="wikitable sortable" style="font-size:12pt; width:100%" |- ! Literature ! Species ! Publication Year |- | *Validation...", and the only contributor was "Xysj2012" (talk))
- 12:48, 13 August 2017 Xysj2012 talk contribs deleted page Test6 (content was: "<html> <iframe frameborder=0 width=1000 height=680 marginheight=0 marginwidth=0 scrolling=yes src=http://127.0.0.1/00-Test/phpweb/0...", and the only contributor was "Xysj2012" (talk))
- 12:41, 13 August 2017 Xysj2012 talk contribs uploaded a new version of File:Species.png
- 03:33, 13 August 2017 Xysj2012 talk contribs uploaded a new version of File:Gene Ontology 1.png
- 03:33, 13 August 2017 Xysj2012 talk contribs uploaded a new version of File:Experiment Ontology 1.png
- 03:30, 13 August 2017 Xysj2012 talk contribs uploaded File:Experiment Ontology 1.png
- 03:28, 13 August 2017 Xysj2012 talk contribs uploaded File:Gene Ontology 1.png
- 03:04, 13 August 2017 Xysj2012 talk contribs uploaded File:Species 1.png
- 11:54, 12 August 2017 Xysj2012 talk contribs uploaded File:Species.png
- 10:41, 12 August 2017 Xysj2012 talk contribs uploaded a new version of File:Gene Ontology.png
- 10:40, 12 August 2017 Xysj2012 talk contribs uploaded a new version of File:Experiment Ontology.png
- 10:37, 12 August 2017 Xysj2012 talk contribs uploaded File:Experiment Ontology.png
- 10:36, 12 August 2017 Xysj2012 talk contribs uploaded File:Gene Ontology.png
- 08:26, 12 August 2017 Xysj2012 talk contribs deleted page Category:RPSA (content was: "*RPSA", and the only contributor was "ICG Expert4" (talk))
- 10:57, 11 August 2017 Xysj2012 talk contribs uploaded File:Eif 1.png
- 06:44, 11 August 2017 Xysj2012 talk contribs deleted page Gene:RPSA (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous ! Application scenarios ! Publication ! Year |} =='''''Externa...")
- 06:33, 11 August 2017 Xysj2012 talk contribs uploaded File:RPL.png
- 04:20, 11 August 2017 Xysj2012 talk contribs uploaded File:AP1.png
- 04:18, 11 August 2017 Xysj2012 talk contribs uploaded a new version of File:AP.png
- 04:18, 11 August 2017 Xysj2012 talk contribs deleted page File:AP.png (Deleted old revision 20170811041821!AP.png)
- 04:18, 11 August 2017 Xysj2012 talk contribs uploaded a new version of File:AP.png
- 02:23, 11 August 2017 Xysj2012 talk contribs deleted page Category:MiRNA (content was: "* miRNA")
- 14:07, 10 August 2017 Xysj2012 talk contribs deleted page Category:SF3A1 (content was: "*SF3A1", and the only contributor was "ICG Expert4" (talk))
- 14:04, 10 August 2017 Xysj2012 talk contribs deleted page Category:EF2 (content was: "*EF2", and the only contributor was "ICG Expert4" (talk))
- 14:02, 10 August 2017 Xysj2012 talk contribs deleted page Category:U2AF (content was: "*U2AF", and the only contributor was "ICG Expert4" (talk))
- 14:01, 10 August 2017 Xysj2012 talk contribs deleted page Category:EF4 (content was: "*TPC2L", and the only contributor was "ICG Expert4" (talk))
- 10:40, 10 August 2017 Xysj2012 talk contribs uploaded File:ARM.png
- 01:53, 10 August 2017 Xysj2012 talk contribs moved page Oak to Cork oak without leaving a redirect
- 08:00, 9 August 2017 Xysj2012 talk contribs uploaded File:Human EF1A.png
- 07:56, 9 August 2017 Xysj2012 talk contribs uploaded File:Sedum tublin.png
- 05:25, 8 August 2017 Xysj2012 talk contribs deleted page Category:EF1γ (content was: "*EF1γ", and the only contributor was "ICG Expert4" (talk))
- 05:21, 8 August 2017 Xysj2012 talk contribs deleted page Category:B3M (content was: "*B3M", and the only contributor was "ICG Expert4" (talk))
- 05:20, 8 August 2017 Xysj2012 talk contribs deleted page Category:SnoR23 (content was: "*SnoR23", and the only contributor was "ICG Expert4" (talk))
- 05:35, 7 August 2017 User account Yang Zhang talk contribs was created by Xysj2012 talk contribs
- 05:39, 5 August 2017 Xysj2012 talk contribs moved page Gene:EF1α to Gene:EF1A without leaving a redirect
- 02:55, 5 August 2017 Xysj2012 talk contribs deleted page Gene:EF4 (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 14:00, 4 August 2017 Xysj2012 talk contribs deleted page Gene:MiR-22a (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 11:12, 4 August 2017 Xysj2012 talk contribs deleted page Category:MiR-23a (content was: "*MiR-23a", and the only contributor was "ICG Expert4" (talk))
- 11:12, 4 August 2017 Xysj2012 talk contribs deleted page Category:MiR-22a (content was: "*MiR-22a", and the only contributor was "ICG Expert4" (talk))
- 11:11, 4 August 2017 Xysj2012 talk contribs deleted page Category:Mi167 (content was: "*Mi167", and the only contributor was "ICG Expert4" (talk))
- 11:09, 4 August 2017 Xysj2012 talk contribs deleted page Gene:MiR-23a (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 11:05, 4 August 2017 Xysj2012 talk contribs deleted page Category:Mi159 (content was: "*Mi159", and the only contributor was "ICG Expert4" (talk))
- 11:05, 4 August 2017 Xysj2012 talk contribs deleted page Gene:Mi159 (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 11:04, 4 August 2017 Xysj2012 talk contribs deleted page Gene:Mi167 (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 11:00, 4 August 2017 Xysj2012 talk contribs deleted page Gene:SnoR23 (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 10:59, 4 August 2017 Xysj2012 talk contribs moved page Category:Category:Small RNAs to Category:Small RNAs without leaving a redirect
- 10:59, 4 August 2017 Xysj2012 talk contribs moved page Category:SnoR14 to Category:Category:Small RNAs without leaving a redirect
- 10:57, 4 August 2017 Xysj2012 talk contribs moved page Gene:SnoR14 to Gene:Small RNAs without leaving a redirect
- 08:48, 4 August 2017 Xysj2012 talk contribs deleted page Category:B10M (content was: "*B10M", and the only contributor was "ICG Expert4" (talk))
- 08:47, 4 August 2017 Xysj2012 talk contribs deleted page Gene:B8M (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 08:47, 4 August 2017 Xysj2012 talk contribs deleted page Gene:B4M (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 08:46, 4 August 2017 Xysj2012 talk contribs deleted page Category:B7M (content was: "*B7M", and the only contributor was "ICG Expert4" (talk))
- 08:46, 4 August 2017 Xysj2012 talk contribs deleted page Category:B6M (content was: "*B6M", and the only contributor was "ICG Expert4" (talk))
- 08:46, 4 August 2017 Xysj2012 talk contribs deleted page Category:B5M (content was: "*B5M", and the only contributor was "ICG Expert4" (talk))
- 08:45, 4 August 2017 Xysj2012 talk contribs deleted page Category:B4M (content was: "*B4M", and the only contributor was "ICG Expert4" (talk))
- 08:44, 4 August 2017 Xysj2012 talk contribs deleted page Category:B8M (content was: "*B8M", and the only contributor was "ICG Expert4" (talk))
- 08:44, 4 August 2017 Xysj2012 talk contribs deleted page Category:B9M (content was: "*B9M", and the only contributor was "ICG Expert4" (talk))
- 08:13, 4 August 2017 Xysj2012 talk contribs deleted page Category:26S rRNA (content was: "26S rRNA", and the only contributor was "Xysj2012" (talk))
- 07:57, 4 August 2017 Xysj2012 talk contribs deleted page Gene:EF3 (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous ! Application scenarios ! Publication ! Year |- |align="center"|...")
- 07:51, 4 August 2017 Xysj2012 talk contribs deleted page Category:EF3 (content was: "*EF3", and the only contributor was "ICG Expert4" (talk))
- 07:48, 4 August 2017 Xysj2012 talk contribs deleted page Gene:EF2 (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous ! Application scenarios ! Publication ! Year |} =='''''Externa...")
- 07:09, 4 August 2017 Xysj2012 talk contribs deleted page Gene:EF1γ (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous ! Application scenarios ! Publication ! Year |} =='''''Externa...")
- 06:48, 4 August 2017 Xysj2012 talk contribs deleted page Category:CYB (content was: "* CYB", and the only contributor was "Xysj2012" (talk))
- 06:47, 4 August 2017 Xysj2012 talk contribs deleted page Category:CYCA (content was: "*CYCA", and the only contributor was "ICG Expert4" (talk))
- 02:37, 4 August 2017 Xysj2012 talk contribs deleted page Gene:PPI (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous ! Application scenarios ! Publication ! Year |- |align="center"|...")
- 02:37, 4 August 2017 Xysj2012 talk contribs deleted page Category:PPI (content was: "*PPI", and the only contributor was "ICG Expert4" (talk))
- 02:15, 4 August 2017 Xysj2012 talk contribs deleted page Gene:COX (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 02:07, 4 August 2017 Xysj2012 talk contribs moved page Gene:CYC to Gene:Cyclophilin without leaving a redirect
- 02:06, 4 August 2017 Xysj2012 talk contribs deleted page Category:CYC (content was: "*CYC", and the only contributor was "ICG Expert4" (talk))
- 01:46, 4 August 2017 Xysj2012 talk contribs moved page Gene:SF3A1 to Gene:SF without leaving a redirect
- 16:24, 3 August 2017 Xysj2012 talk contribs uploaded File:Human ACT.png
- 03:30, 3 August 2017 Xysj2012 talk contribs deleted page Gene:ADP (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Species ! Gene Synonymous ! Application scenarios ! Publication ! Year |} =='''''Extern...")
- 02:59, 3 August 2017 Xysj2012 talk contribs deleted page Gene:25S rRNA (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 02:58, 3 August 2017 Xysj2012 talk contribs deleted page Gene:16S rRNA (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 02:56, 3 August 2017 Xysj2012 talk contribs deleted page Category:16S rRNA (content was: "*16S rRNA", and the only contributor was "ICG Expert4" (talk))
- 02:54, 3 August 2017 Xysj2012 talk contribs deleted page Gene:5.8S rRNA (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 02:52, 3 August 2017 Xysj2012 talk contribs moved page Gene:28S rRNA to Gene:Other rRNA without leaving a redirect
- 02:50, 3 August 2017 Xysj2012 talk contribs deleted page Category:5.8S rRNA (content was: "*5.8S rRNA", and the only contributor was "ICG Expert4" (talk))
- 02:49, 3 August 2017 Xysj2012 talk contribs deleted page Category:25S rRNA (content was: "*25S rRNA", and the only contributor was "ICG Expert4" (talk))
- 02:37, 3 August 2017 Xysj2012 talk contribs moved page Category:RRNA to Category:Other rRNA without leaving a redirect
- 02:36, 3 August 2017 Xysj2012 talk contribs moved page Category:28S rRNA to Category:RRNA without leaving a redirect
- 15:11, 2 August 2017 Xysj2012 talk contribs deleted page Gene:CYCA (content was: "=='''''Synonymous Genes'''''== =='''''Experimental Validated ICGs'''''== {|class="wikitable sortable" style="font-size:10...", and the only contributor was "Wangzhennan" (talk))
- 10:24, 2 August 2017 Xysj2012 talk contribs deleted page Gene:60SRP (Deleted to make way for move from "Gene"60SRP")
- 10:24, 2 August 2017 Xysj2012 talk contribs moved page Gene"60SRP to Gene:60SRP without leaving a redirect
- 10:24, 2 August 2017 Xysj2012 talk contribs moved page Gene"60SRP to Gene:60SRP
- 15:06, 22 July 2017 Xysj2012 talk contribs moved page Manihot esculenta Crantz to Manihot esculenta without leaving a redirect
- 14:38, 15 July 2017 User account Jian Sang talk contribs was created by Xysj2012 talk contribs
- 04:23, 15 July 2017 User account Cao Jiabao talk contribs was created by Xysj2012 talk contribs
- 04:21, 15 July 2017 User account Niu Guangyi talk contribs was created by Xysj2012 talk contribs
- 04:18, 15 July 2017 User account Li Man talk contribs was created by Xysj2012 talk contribs
- 01:32, 13 July 2017 User account Wangzhennan talk contribs was created by Xysj2012 talk contribs
- 12:09, 29 June 2017 Xysj2012 talk contribs uploaded File:Address.jpg
- 15:22, 28 June 2017 Xysj2012 talk contribs uploaded a new version of File:Rplot2 Experiment.png
- 15:22, 28 June 2017 Xysj2012 talk contribs uploaded a new version of File:Rplot Gene.png
- 10:58, 28 June 2017 Xysj2012 talk contribs moved page Bivalve Mollusc to Pecten maximus without leaving a redirect
- 09:00, 27 June 2017 Xysj2012 talk contribs uploaded File:Phytophthora parasitica.png
- 08:54, 27 June 2017 Xysj2012 talk contribs uploaded File:Leptospira interrogans.png
- 08:42, 27 June 2017 Xysj2012 talk contribs uploaded File:Francisella noatunensis.png
- 08:32, 27 June 2017 Xysj2012 talk contribs uploaded File:Corynebacterium pseudotuberculosis.png
- 07:51, 27 June 2017 Xysj2012 talk contribs uploaded File:Valsa mali.png
- 07:37, 27 June 2017 Xysj2012 talk contribs uploaded File:Tuber melanosporum.png
- 06:52, 27 June 2017 Xysj2012 talk contribs uploaded File:Saccharomyces cerevisiae.png
- 06:24, 27 June 2017 Xysj2012 talk contribs uploaded File:Penicillium echinulatum.png
- 06:14, 27 June 2017 Xysj2012 talk contribs uploaded File:Pandora neoaphidis.png
- 02:48, 27 June 2017 Xysj2012 talk contribs uploaded File:Neurospora crassa.png
- 02:34, 27 June 2017 Xysj2012 talk contribs uploaded File:Cordyceps militaris.png
- 02:26, 27 June 2017 Xysj2012 talk contribs uploaded a new version of File:Aspergillus niger.png
- 02:20, 27 June 2017 Xysj2012 talk contribs uploaded File:Aspergillus niger.png
- 02:15, 26 June 2017 Xysj2012 talk contribs uploaded File:Brassica oleracea.png
- 02:09, 26 June 2017 Xysj2012 talk contribs moved page Fragaria × ananassa to Fragaria ananassa without leaving a redirect
- 02:02, 26 June 2017 Xysj2012 talk contribs uploaded File:Brassica napus.png
- 01:54, 26 June 2017 Xysj2012 talk contribs uploaded File:Brachypodium distachyon.png
- 01:45, 26 June 2017 Xysj2012 talk contribs uploaded File:Brachiaria brizantha.png
- 01:19, 26 June 2017 Xysj2012 talk contribs uploaded File:Arachis hypogaea.png
- 15:57, 25 June 2017 Xysj2012 talk contribs uploaded File:Arabidopsis thaliana.png
- 15:48, 25 June 2017 Xysj2012 talk contribs uploaded File:Anthurium andraeanum.png
- 15:38, 25 June 2017 Xysj2012 talk contribs uploaded File:Agrostis stolonifera.png
- 15:11, 25 June 2017 Xysj2012 talk contribs moved page Species:Plants to Species:Plant without leaving a redirect
- 15:07, 25 June 2017 Xysj2012 talk contribs uploaded File:Artemisia annua.png
- 14:10, 25 June 2017 Xysj2012 talk contribs uploaded File:Ammopiptanthus mongolicus.png
- 04:16, 25 June 2017 Xysj2012 talk contribs uploaded File:Fragaria ananassa.png
- 04:07, 25 June 2017 Xysj2012 talk contribs uploaded File:Jatropha curcas.png
- 04:07, 25 June 2017 Xysj2012 talk contribs uploaded File:Glycine max.png
- 04:06, 25 June 2017 Xysj2012 talk contribs uploaded File:Atropa belladonna.png
- 03:59, 25 June 2017 Xysj2012 talk contribs uploaded File:Actinidia chinensis.png
- 09:26, 24 June 2017 Xysj2012 talk contribs uploaded a new version of File:Species highcharts.png
- 09:00, 24 June 2017 Xysj2012 talk contribs uploaded File:Species highcharts.png
- 07:58, 24 June 2017 Xysj2012 talk contribs uploaded File:Rplot2 Experiment.png
- 16:53, 23 June 2017 Xysj2012 talk contribs uploaded File:Rplot Gene.png
- 07:24, 22 June 2017 Xysj2012 talk contribs moved page Freshwater Prawn to Macrobrachium olfersii without leaving a redirect
- 08:40, 17 June 2017 Xysj2012 talk contribs uploaded File:REFqPCR200903.jpg
- 08:25, 17 June 2017 Xysj2012 talk contribs uploaded File:REFqPCR200902.jpg
- 07:58, 17 June 2017 Xysj2012 talk contribs uploaded File:REFqPCR200901.jpg
- 07:28, 17 June 2017 Xysj2012 talk contribs uploaded File:REFqPCR200808.jpeg
- 07:07, 17 June 2017 Xysj2012 talk contribs uploaded File:REFqPCR200807.jpg
- 06:56, 17 June 2017 Xysj2012 talk contribs uploaded File:REFqPCR200806.jpg
- 06:49, 17 June 2017 Xysj2012 talk contribs uploaded File:REFqPCR200805.jpg
- 06:34, 17 June 2017 Xysj2012 talk contribs uploaded File:REFqPCR200804.jpg
- 06:28, 17 June 2017 Xysj2012 talk contribs uploaded File:REFqPCR200801.jpg
- 13:56, 16 June 2017 Xysj2012 talk contribs uploaded File:1200px-REFqPCR200802.jpg
- 02:54, 16 June 2017 User account ICG Expert4 talk contribs was created by Xysj2012 talk contribs
- 02:53, 16 June 2017 User account ICG Expert3 talk contribs was created by Xysj2012 talk contribs
- 02:53, 16 June 2017 User account ICG Expert2 talk contribs was created by Xysj2012 talk contribs
- 12:48, 15 June 2017 Xysj2012 talk contribs deleted page Test (content was: "=='''First_Test5_2005'''== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- |align="center"| * Homo sapiens |align="center"| * Mus musculus |align="center"| * Rattus norvegicus |align="center"| * Glycin...")
- 09:56, 15 June 2017 User account ICG Expert1 talk contribs was created by Xysj2012 talk contribs
