View source for Spodoptera exigua

==Description==
[[File:Spodoptera exigua.png|right|200px|link=Spodoptera exigua]]
* '''''Spodoptera exigua''''' is a widespread and polyphagous lepidopteran pest that causes severe economic damage in both dicotyledon and monocotyledon crops and flower species. It is native to Asia, but has been introduced worldwide and is now found almost anywhere its host crops are grown. The voracious larvae are the main culprits. It has recently become a major economic cotton pest in China, probably due to the reduced pesticide usage attributed to adoption of Bt cotton producing the Cry1Ac protein<ref name="ref1"/><ref name="ref2"/>.
* <font color=blue>'''Common Name:'''</font> '''Beet armyworm''', '''Small mottled willow moth'''
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=7107 <font color=blue>'''NCBI Taxonomy'''</font>]

=='''''Different Developmental Stages & Tissues'''''==
===Internal Control Genes===
{|class="wikitable sortable" style="font-size:10pt; width:100%"
|-
! Gene Symbol  
! Gene Name 
! style="width=25%　font-size:9pt　"|Application Scope 
! Accession Number 
! Primers (5'-3')<br>[Forward/Reverse]
! Size [bp] 
! Tm [℃]
! Detection
|-
|align="center"| L10<ref name="ref1"/>
|align="center"| Ribosomal protein L10
|
* Epidermis, head, midgut, fat body and hemolymph
|align="center"| [https://www.cbi.nlm.nih.gov/nuccore/160947857 '''EU258622'''] 
|nowrap style="font-size:9pt"|
* F:GGCTACGGTCGACGACTTCCC
* R:GCAGCCTCATGCGGATGTGGAAC
|align="center"|  155 
|align="center"| 60
|align="center"| EvaGreen
|-
|align="center"| EF2<ref name="ref1"/>
|align="center"| Elongation factor 2
|
* Epidermis, head, midgut, fat body and hemolymph
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/28627568 '''AY078407'''] 
|nowrap style="font-size:9pt"|
* F:CTGACCGCGCAACCCAGACT
* R:CACGAACATGGGGGTACCAGCG
|align="center"|  150 
|align="center"| 60
|align="center"| EvaGreen
|-
|align="center"| L7A<ref name="ref1"/>
|align="center"| Ribosomal protein L7A
|
* Epidermis, head, midgut, fat body and hemolymph
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/161015754 '''EU259814'''] 
|nowrap style="font-size:9pt"|
* F:TGAGCTTGTCCTCTTCCTGCCC
* R:GCTGCACGGTCGCCAGACTC
|align="center"|  150 
|align="center"| 60
|align="center"| EvaGreen
|-
|align="center"| ACT2<ref name="ref1"/>
|align="center"| β-actin2
|
* larvae samples for pupae and adults 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/339283893 '''JF728814'''] 
|nowrap style="font-size:9pt"|
* F:GGCTGCCGACATAGACATGCG
* R:GGGTCCTCCACGCGGATCTT
|align="center"|  180 
|align="center"| 60
|align="center"| EvaGreen
|-
|align="center"| ACT1<ref name="ref1"/>
|align="center"| β-actin1
|
* Larvae samples
* All developmental stage
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/339283893 '''JF728814'''] 
|nowrap style="font-size:9pt"|
* F:AAGCCTTCGATGCCACCGGGTA
* R:TTCGGGCGTGTTTAGTGGAGGC
|align="center"|  170 
|align="center"| 60
|align="center"| EvaGreen
|-
|align="center"| GAPDH<ref name="ref1"/>
|align="center"| Glyceralde hyde-3-phosphate dehydrogen ase
|
* All developmental stage
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/339283895 '''JF728815'''] 
|nowrap style="font-size:9pt"|
* F:CTGAGGAACAGGTCGTGTCATCCGA
* R:GATCGATAACGCGGTTGGAGTAGCC
|align="center"|  150 
|align="center"| 60
|align="center"| EvaGreen
|-
|align="center"| SOD<ref name="ref1"/>
|align="center"| Superoxide dismutase
|
* Females
* ALl evelopmental stage sample groups 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/160221247 '''EU263634'''] 
|nowrap style="font-size:9pt"|
* F:GCCGTGTGTGTTCTCAAGGGCG
* R:GCGCCAGCTGACGTGCATCC
|align="center"|  170 
|align="center"| 60
|align="center"| EvaGreen
|}

===Molecular Types===
*mRNA

===Evaluation Methods=== 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']

===Contact===
*'''Name''': Xun Zhu 
*'''Email''': jianhl@mail.hzau.edu.cn
*'''Institution''': Laboratory of Pesticide, College of Plant Science & Technology, Huazhong Agricultural University, Wuhan, China

===Citation Statistics===
Cited by [https://scholar.google.com/scholar?cites=11157445239161262192&as_sdt=2005&sciodt=0,5&hl=en '''40'''] (Based on Google Scholar [2017-09-01])

=='''References'''==
<references>
<ref name="ref1">
Zhu X, Yuan M, Shakeel M, et al. (2014) Selection and evaluation of reference genes for expression analysis using qRT-PCR in the beet armyworm Spodoptera exigua (Hubner) (Lepidoptera: Noctuidae). PLoS One 9, e84730.
</ref>
<ref name="ref2">
Qiu L, Cui SH, Liu L, et al. (2017) Aminopeptidase N1 is involved in Bacillus thuringiensis Cry1Ac toxicity in the beet armyworm, Spodoptera exigua. Scientific Reports 7.
</ref>
</references>

=='''Categories'''==
[[Category:Animals]]
[[Category:mRNA]][[Category:EvaGreen]]
[[Category:ACT]] [[Category:ACT]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:RPL]] [[Category:RPL]] [[Category:SOD]]
[[Category:Different Tissues]]  [[Category:Different Developmental Stages]]
[[Category:geNorm]]
[[Category:NormFinder]]
[[Category:BestKeeper]]