Difference between revisions of "Spodoptera exigua"

From ICG
Jump to navigation Jump to search
 
(18 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:beet-armyworm.jpg|right|327px|]]
+
[[File:Spodoptera exigua.png|right|200px|link=Spodoptera exigua]]
* The beet armyworm, Spodoptera exigua (Lepidoptera: Noctuidae), is a widespread and polyphagous lepidopteran pest that causes severe economic damage in both dicotyledon (e.g., sugar beet, alfalfa, cotton, chrysanthemum) and monocotyledon (e.g., rice) crops and flower species.
+
* '''''Spodoptera exigua''''' is a widespread and polyphagous lepidopteran pest that causes severe economic damage in both dicotyledon and monocotyledon crops and flower species. It is native to Asia, but has been introduced worldwide and is now found almost anywhere its host crops are grown. The voracious larvae are the main culprits. It has recently become a major economic cotton pest in China, probably due to the reduced pesticide usage attributed to adoption of Bt cotton producing the Cry1Ac protein<ref name="ref1"/><ref name="ref2"/>.
* The beet armyworm, Spodoptera exigua, has recently become a major economic cotton pest in China, probably due to the reduced pesticide usage attributed to adoption of Bt cotton producing the Cry1Ac protein.
+
* <font color=blue>'''Common Name:'''</font> '''Beet armyworm''', '''Small mottled willow moth'''
* The beet armyworm or small mottled willow moth (Spodoptera exigua) is one of the best-known agricultural pest insects. It is also known as the asparagus fern caterpillar. It is native to Asia, but has been introduced worldwide and is now found almost anywhere its many host crops are grown. The voracious larvae are the main culprits. In the British Isles, where it is an introduced species and not known to breed, the adult moth is known as the small mottled willow. <ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=7107 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Different Developmental Stages & Tissues'''''==
 
=='''''Different Developmental Stages & Tissues'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 19: Line 19:
 
|-
 
|-
 
|align="center"| L10<ref name="ref1"/>
 
|align="center"| L10<ref name="ref1"/>
|align="center"| ribosomal protein L10
+
|align="center"| Ribosomal protein L10
 
|
 
|
* Universial reference gene
+
* Epidermis, head, midgut, fat body and hemolymph
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/160947857 '''EU258622''']  
+
|align="center"| [https://www.cbi.nlm.nih.gov/nuccore/160947857 '''EU258622''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GGCTACGGTCGACGACTTCCC
 
* F:GGCTACGGTCGACGACTTCCC
Line 31: Line 31:
 
|-
 
|-
 
|align="center"| EF2<ref name="ref1"/>
 
|align="center"| EF2<ref name="ref1"/>
|align="center"| elongation factor 2
+
|align="center"| Elongation factor 2
 
|
 
|
* Universial reference gene
+
* Epidermis, head, midgut, fat body and hemolymph
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/28627568 '''AY078407''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/28627568 '''AY078407''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 43: Line 43:
 
|-
 
|-
 
|align="center"| L7A<ref name="ref1"/>
 
|align="center"| L7A<ref name="ref1"/>
|align="center"| ribosomal protein L7A
+
|align="center"| Ribosomal protein L7A
 
|
 
|
* Universial reference gene
+
* Epidermis, head, midgut, fat body and hemolymph
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/161015754 '''EU259814''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/161015754 '''EU259814''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 105: Line 105:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 118: Line 119:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''37''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=11157445239161262192&as_sdt=2005&sciodt=0,5&hl=en '''40'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 129: Line 130:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
 [[Category:mRNA]][[Category:EvaGreen]] 
+
[[Category:mRNA]][[Category:EvaGreen]]
[[Category:ACT]] [[Category:ACT]] [[Category:EF2]] [[Category:GAPDH]] [[Category:RPL]] [[Category:RPL]] [[Category:SOD]]
+
[[Category:ACT]] [[Category:ACT]] [[Category:EF1α]] [[Category:GAPDH]] [[Category:RPL]] [[Category:RPL]] [[Category:SOD]]
 
[[Category:Different Tissues]]  [[Category:Different Developmental Stages]]
 
[[Category:Different Tissues]]  [[Category:Different Developmental Stages]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 04:45, 1 September 2017

Description

Spodoptera exigua.png
  • Spodoptera exigua is a widespread and polyphagous lepidopteran pest that causes severe economic damage in both dicotyledon and monocotyledon crops and flower species. It is native to Asia, but has been introduced worldwide and is now found almost anywhere its host crops are grown. The voracious larvae are the main culprits. It has recently become a major economic cotton pest in China, probably due to the reduced pesticide usage attributed to adoption of Bt cotton producing the Cry1Ac protein[1][2].
  • Common Name: Beet armyworm, Small mottled willow moth
  • NCBI Taxonomy

Different Developmental Stages & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
L10[1] Ribosomal protein L10
  • Epidermis, head, midgut, fat body and hemolymph
EU258622
  • F:GGCTACGGTCGACGACTTCCC
  • R:GCAGCCTCATGCGGATGTGGAAC
155 60 EvaGreen
EF2[1] Elongation factor 2
  • Epidermis, head, midgut, fat body and hemolymph
AY078407
  • F:CTGACCGCGCAACCCAGACT
  • R:CACGAACATGGGGGTACCAGCG
150 60 EvaGreen
L7A[1] Ribosomal protein L7A
  • Epidermis, head, midgut, fat body and hemolymph
EU259814
  • F:TGAGCTTGTCCTCTTCCTGCCC
  • R:GCTGCACGGTCGCCAGACTC
150 60 EvaGreen
ACT2[1] β-actin2
  • larvae samples for pupae and adults
JF728814
  • F:GGCTGCCGACATAGACATGCG
  • R:GGGTCCTCCACGCGGATCTT
180 60 EvaGreen
ACT1[1] β-actin1
  • Larvae samples
  • All developmental stage
JF728814
  • F:AAGCCTTCGATGCCACCGGGTA
  • R:TTCGGGCGTGTTTAGTGGAGGC
170 60 EvaGreen
GAPDH[1] Glyceralde hyde-3-phosphate dehydrogen ase
  • All developmental stage
JF728815
  • F:CTGAGGAACAGGTCGTGTCATCCGA
  • R:GATCGATAACGCGGTTGGAGTAGCC
150 60 EvaGreen
SOD[1] Superoxide dismutase
  • Females
  • ALl evelopmental stage sample groups
EU263634
  • F:GCCGTGTGTGTTCTCAAGGGCG
  • R:GCGCCAGCTGACGTGCATCC
170 60 EvaGreen

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xun Zhu
  • Email: jianhl@mail.hzau.edu.cn
  • Institution: Laboratory of Pesticide, College of Plant Science & Technology, Huazhong Agricultural University, Wuhan, China

Citation Statistics

Cited by 40 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Zhu X, Yuan M, Shakeel M, et al. (2014) Selection and evaluation of reference genes for expression analysis using qRT-PCR in the beet armyworm Spodoptera exigua (Hubner) (Lepidoptera: Noctuidae). PLoS One 9, e84730.
  2. Qiu L, Cui SH, Liu L, et al. (2017) Aminopeptidase N1 is involved in Bacillus thuringiensis Cry1Ac toxicity in the beet armyworm, Spodoptera exigua. Scientific Reports 7.

Categories