Spodoptera exigua

From ICG
Jump to navigation Jump to search

Description

Beet-armyworm.jpg
  • The beet armyworm, Spodoptera exigua (Lepidoptera: Noctuidae), is a widespread and polyphagous lepidopteran pest that causes severe economic damage in both dicotyledon (e.g., sugar beet, alfalfa, cotton, chrysanthemum) and monocotyledon (e.g., rice) crops and flower species.
  • The beet armyworm, Spodoptera exigua, has recently become a major economic cotton pest in China, probably due to the reduced pesticide usage attributed to adoption of Bt cotton producing the Cry1Ac protein.
  • The beet armyworm or small mottled willow moth (Spodoptera exigua) is one of the best-known agricultural pest insects. It is also known as the asparagus fern caterpillar. It is native to Asia, but has been introduced worldwide and is now found almost anywhere its many host crops are grown. The voracious larvae are the main culprits. In the British Isles, where it is an introduced species and not known to breed, the adult moth is known as the small mottled willow. [1] [2].

Different Tissues & Developmental Stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
L10[1] ribosomal protein L10
  • Universial reference gene
EU258622
  • F:GGCTACGGTCGACGACTTCCC
  • R:GCAGCCTCATGCGGATGTGGAAC
155 60 EvaGreen
EF2[1] elongation factor 2
  • Universial reference gene
AY078407
  • F:CTGACCGCGCAACCCAGACT
  • R:CACGAACATGGGGGTACCAGCG
150 60 EvaGreen
L7A[1] ribosomal protein L7A
  • Universial reference gene
EU259814
  • F:TGAGCTTGTCCTCTTCCTGCCC
  • R:GCTGCACGGTCGCCAGACTC
150 60 EvaGreen
ACT2[1] β-actin2
  • larvae samples for pupae and adults
JF728814
  • F:GGCTGCCGACATAGACATGCG
  • R:GGGTCCTCCACGCGGATCTT
180 60 EvaGreen
ACT1[1] β-actin1
  • Larvae samples
  • All developmental stage
JF728814
  • F:AAGCCTTCGATGCCACCGGGTA
  • R:TTCGGGCGTGTTTAGTGGAGGC
170 60 EvaGreen
GAPDH[1] Glyceralde hyde-3-phosphate dehydrogen ase
  • All developmental stage
JF728815
  • F:CTGAGGAACAGGTCGTGTCATCCGA
  • R:GATCGATAACGCGGTTGGAGTAGCC
150 60 EvaGreen
SOD[1] Superoxide dismutase
  • Females
  • ALl evelopmental stage sample groups
EU263634
  • F:GCCGTGTGTGTTCTCAAGGGCG
  • R:GCGCCAGCTGACGTGCATCC
170 60 EvaGreen

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xun Zhu
  • Email: jianhl@mail.hzau.edu.cn
  • Institution: Laboratory of Pesticide, College of Plant Science & Technology, Huazhong Agricultural University, Wuhan, China

Citation Statistics

Cited by 37 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Zhu X, Yuan M, Shakeel M, et al. (2014) Selection and evaluation of reference genes for expression analysis using qRT-PCR in the beet armyworm Spodoptera exigua (Hubner) (Lepidoptera: Noctuidae). PLoS One 9, e84730.
  2. Qiu L, Cui SH, Liu L, et al. (2017) Aminopeptidase N1 is involved in Bacillus thuringiensis Cry1Ac toxicity in the beet armyworm, Spodoptera exigua. Scientific Reports 7.