Difference between revisions of "Stenella coeruleoalba"

From ICG
Jump to navigation Jump to search
Line 20: Line 20:
 
|align="center"| glyceraldehyde-3-phosphate dehydrogenase
 
|align="center"| glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
*Universal reference genes
+
* Striped Dolphin Skin Biopsies
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404538 '''DQ404538''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404538 '''DQ404538''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 32: Line 32:
 
|align="center"| tyrosine 3-monooxygenase
 
|align="center"| tyrosine 3-monooxygenase
 
|
 
|
*Universal reference genes
+
* Striped Dolphin Skin Biopsies
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404539 '''DQ404539''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404539 '''DQ404539''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 44: Line 44:
 
|align="center"| ribosomal Protein L4  
 
|align="center"| ribosomal Protein L4  
 
|
 
|
*Universal reference genes
+
* Striped Dolphin Skin Biopsies
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404536 '''DQ404536''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404536 '''DQ404536''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 56: Line 56:
 
|align="center"| ribosomal Protein S18  
 
|align="center"| ribosomal Protein S18  
 
|
 
|
*Universal reference genes
+
* Striped Dolphin Skin Biopsies
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404537 '''DQ404537''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404537 '''DQ404537''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 65: Line 65:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
 +
 
===Moleculer Type===
 
===Moleculer Type===
 
* mRNA
 
* mRNA

Revision as of 17:09, 20 June 2017

Description

Stenella coeruleoalba-1.jpg
  • The striped dolphin Stenella coeruleoalba is the most common cetacean in the Mediterranean Sea. It is gregarious and inhabits pelagic waters. Females attain sexual maturity at about 187 cm and 12 years of age, whereas males do so at about 187 cm and 9 years of age. Until a morbillivirus epizootic affected the Med- iterranean striped dolphin, few samples were available to allow reliable studies on its population biology[1][2].

Striped Dolphin Skin

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] glyceraldehyde-3-phosphate dehydrogenase
  • Striped Dolphin Skin Biopsies
DQ404538
  • F:CAAGGCTGTGGGCAAGGTCATC
  • R:TTCTCCAGGCGGCAGGTCAG
111 60 SYBR
YWHAZ[1] tyrosine 3-monooxygenase
  • Striped Dolphin Skin Biopsies
DQ404539
  • F:AAATGAAAGGAGACTACTACCGCTA
  • R:AGACCCAATCTGATAGGATGTGTTG
151 60 SYBR
RPL4[1] ribosomal Protein L4
  • Striped Dolphin Skin Biopsies
DQ404536
  • F:CAGACCTTAGCAGAATCTTGAAAAGC
  • R:CCTGGCGAAGAATGGTGTTCC
171 60 SYBR
RPS18[1] ribosomal Protein S18
  • Striped Dolphin Skin Biopsies
DQ404537
  • F:CAATTAAGGGTGTGGGGCGAAG
  • R:TCTTGTATTGGCGTGGATTCTGC
141 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Giacomo Spinsanti
  • Email: spinsanti@unisi.it
  • Institution: Evolutionary Biology Department, University of Siena, Via A. Moro 2, 53100 Siena, Italy

Citation Statistics

Cited by 100 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 Spinsanti G, Panti C, Lazzeri E, et al. Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba) skin biopsies[J]. BMC molecular biology, 2006, 7(1): 32.
  2. Viale D. Cetaceans in the northwestern Mediterranean: their place in the ecosystem[J]. Oceanography and marine biology, 1985, 23: 491-571.