Difference between revisions of "Stenella coeruleoalba"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name ! style="width=25% font-size:9pt...")
 
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
+
=='''''Striped Dolphin Skin Biopsies'''''==
 
===Reference Genes===
 
===Reference Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
Line 71: Line 71:
 
*'''Email''': spinsanti@unisi.it
 
*'''Email''': spinsanti@unisi.it
 
*'''Institution''': Evolutionary Biology Department, University of Siena, Via A. Moro 2, 53100 Siena, Italy
 
*'''Institution''': Evolutionary Biology Department, University of Siena, Via A. Moro 2, 53100 Siena, Italy
 +
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>

Revision as of 08:46, 16 June 2017

Description

Striped Dolphin Skin Biopsies

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[1] glyceraldehyde-3-phosphate dehydrogenase
  • Universal reference genes
DQ404538
  • F:CAAGGCTGTGGGCAAGGTCATC
  • R:TTCTCCAGGCGGCAGGTCAG
111 60 SYBR
YWHAZ[1] tyrosine 3-monooxygenase
  • Universal reference genes
DQ404539
  • F:AAATGAAAGGAGACTACTACCGCTA
  • R:AGACCCAATCTGATAGGATGTGTTG
151 60 SYBR
RPL4[1] ribosomal Protein L4
  • Universal reference genes
DQ404536
  • F:CAGACCTTAGCAGAATCTTGAAAAGC
  • R:CCTGGCGAAGAATGGTGTTCC
171 60 SYBR
RPS18[1] ribosomal Protein S18
  • Universal reference genes
DQ404537
  • F:CAATTAAGGGTGTGGGGCGAAG
  • R:TCTTGTATTGGCGTGGATTCTGC
141 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Giacomo Spinsanti
  • Email: spinsanti@unisi.it
  • Institution: Evolutionary Biology Department, University of Siena, Via A. Moro 2, 53100 Siena, Italy

References

  1. 1.0 1.1 1.2 1.3