Difference between revisions of "Stenella coeruleoalba"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name ! style="width=25% font-size:9pt...")
 
 
(26 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 +
[[File:Stenella coeruleoalba.png|right|200px|link=Stenella coeruleoalba]]
 +
*'''''Stenella coeruleoalba''''' is the most common  cetacean  in  the Mediterranean  Sea. It is gregarious and inhabits pelagic  waters.  Females  attain  sexual  maturity  at about 187 cm and 12 years of  age, whereas males do so at about 187 cm and 9 years of  age. Until a morbillivirus epizootic affected the Mediterranean striped dolphin, few samples were available to allow reliable studies on its population biology<ref name="ref1"/><ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Striped dolphin'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9737 <font color=blue>'''NCBI Taxonomy'''</font>]
  
===Reference Genes===
+
=='''''Striped Dolphin Skin'''''==
 +
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 8: Line 13:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 14: Line 19:
 
|-
 
|-
 
|align="center"| GAPDH<ref name="ref1"/>
 
|align="center"| GAPDH<ref name="ref1"/>
|align="center"| glyceraldehyde-3-phosphate dehydrogenase
+
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
*Universal reference genes
+
* Striped Dolphin Skin Biopsies
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404538 '''DQ404538''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404538 '''DQ404538''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 26: Line 31:
 
|-
 
|-
 
|align="center"| YWHAZ<ref name="ref1"/>
 
|align="center"| YWHAZ<ref name="ref1"/>
|align="center"| tyrosine 3-monooxygenase
+
|align="center"| Tyrosine 3-monooxygenase
 
|
 
|
*Universal reference genes
+
* Striped Dolphin Skin Biopsies
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404539 '''DQ404539''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404539 '''DQ404539''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 38: Line 43:
 
|-
 
|-
 
|align="center"| RPL4<ref name="ref1"/>
 
|align="center"| RPL4<ref name="ref1"/>
|align="center"| ribosomal Protein L4  
+
|align="center"| Ribosomal Protein L4  
 
|
 
|
*Universal reference genes
+
* Striped Dolphin Skin Biopsies
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404536 '''DQ404536''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404536 '''DQ404536''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 50: Line 55:
 
|-
 
|-
 
|align="center"| RPS18<ref name="ref1"/>
 
|align="center"| RPS18<ref name="ref1"/>
|align="center"| ribosomal Protein S18  
+
|align="center"| Ribosomal Protein S18  
 
|
 
|
*Universal reference genes
+
* Striped Dolphin Skin Biopsies
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404537 '''DQ404537''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/DQ404537 '''DQ404537''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 61: Line 66:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer Type===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 71: Line 78:
 
*'''Email''': spinsanti@unisi.it
 
*'''Email''': spinsanti@unisi.it
 
*'''Institution''': Evolutionary Biology Department, University of Siena, Via A. Moro 2, 53100 Siena, Italy
 
*'''Institution''': Evolutionary Biology Department, University of Siena, Via A. Moro 2, 53100 Siena, Italy
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=13538637379720126668&as_sdt=2005&sciodt=0,5&hl=en '''99'''] (Based on Google Scholar [2017-09-01])
 +
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
 +
Spinsanti G, Panti C, Lazzeri E, Marsili L, Casini S, Frati F, Fossi CM. Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba) skin biopsies. BMC Mol Biol. 2006 Sep 19;7:32. PubMed PMID: 16984641.
 +
</ref>
 +
<ref name="ref2">
 +
Viale D. Cetaceans in the northwestern Mediterranean: their place in the ecosystem[J]. Oceanography and marine biology, 1985, 23: 491-571.
 
</ref>
 
</ref>
Spinsanti G, Panti C, Lazzeri E, et al. Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba) skin biopsies[J]. BMC molecular biology, 2006, 7(1): 32.
 
 
</references>
 
</references>
 +
 +
=='''Categories'''==
 +
[[Category:Animals]]
 +
[[Category:mRNA]]
 +
 +
[[Category:SYBR]]
 +
[[Category:GAPDH]] [[Category:RPL]] [[Category:RPS]] [[Category:YWHAZ]]
 +
[[Category:Specific Tissue]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 01:43, 11 September 2017

Description

Stenella coeruleoalba.png
  • Stenella coeruleoalba is the most common cetacean in the Mediterranean Sea. It is gregarious and inhabits pelagic waters. Females attain sexual maturity at about 187 cm and 12 years of age, whereas males do so at about 187 cm and 9 years of age. Until a morbillivirus epizootic affected the Mediterranean striped dolphin, few samples were available to allow reliable studies on its population biology[1][2].
  • Common Name: Striped dolphin
  • NCBI Taxonomy

Striped Dolphin Skin

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Striped Dolphin Skin Biopsies
DQ404538
  • F:CAAGGCTGTGGGCAAGGTCATC
  • R:TTCTCCAGGCGGCAGGTCAG
111 60 SYBR
YWHAZ[1] Tyrosine 3-monooxygenase
  • Striped Dolphin Skin Biopsies
DQ404539
  • F:AAATGAAAGGAGACTACTACCGCTA
  • R:AGACCCAATCTGATAGGATGTGTTG
151 60 SYBR
RPL4[1] Ribosomal Protein L4
  • Striped Dolphin Skin Biopsies
DQ404536
  • F:CAGACCTTAGCAGAATCTTGAAAAGC
  • R:CCTGGCGAAGAATGGTGTTCC
171 60 SYBR
RPS18[1] Ribosomal Protein S18
  • Striped Dolphin Skin Biopsies
DQ404537
  • F:CAATTAAGGGTGTGGGGCGAAG
  • R:TCTTGTATTGGCGTGGATTCTGC
141 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Giacomo Spinsanti
  • Email: spinsanti@unisi.it
  • Institution: Evolutionary Biology Department, University of Siena, Via A. Moro 2, 53100 Siena, Italy

Citation Statistics

Cited by 99 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Spinsanti G, Panti C, Lazzeri E, Marsili L, Casini S, Frati F, Fossi CM. Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba) skin biopsies. BMC Mol Biol. 2006 Sep 19;7:32. PubMed PMID: 16984641.
  2. Viale D. Cetaceans in the northwestern Mediterranean: their place in the ecosystem[J]. Oceanography and marine biology, 1985, 23: 491-571.

Categories