Difference between revisions of "Stenella coeruleoalba"

Revision as of 14:54, 22 June 2017

The striped dolphin Stenella coeruleoalba is the most common cetacean in the Mediterranean Sea. It is gregarious and inhabits pelagic waters. Females attain sexual maturity at about 187 cm and 12 years of age, whereas males do so at about 187 cm and 9 years of age. Until a morbillivirus epizootic affected the Med- iterranean striped dolphin, few samples were available to allow reliable studies on its population biology^[1]^[2].

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
GAPDH^[1]	glyceraldehyde-3-phosphate dehydrogenase	Striped Dolphin Skin Biopsies	DQ404538	F:CAAGGCTGTGGGCAAGGTCATC R:TTCTCCAGGCGGCAGGTCAG	111	60	SYBR
YWHAZ^[1]	tyrosine 3-monooxygenase	Striped Dolphin Skin Biopsies	DQ404539	F:AAATGAAAGGAGACTACTACCGCTA R:AGACCCAATCTGATAGGATGTGTTG	151	60	SYBR
RPL4^[1]	ribosomal Protein L4	Striped Dolphin Skin Biopsies	DQ404536	F:CAGACCTTAGCAGAATCTTGAAAAGC R:CCTGGCGAAGAATGGTGTTCC	171	60	SYBR
RPS18^[1]	ribosomal Protein S18	Striped Dolphin Skin Biopsies	DQ404537	F:CAATTAAGGGTGTGGGGCGAAG R:TCTTGTATTGGCGTGGATTCTGC	141	60	SYBR

Name: Giacomo Spinsanti
Email: spinsanti@unisi.it
Institution: Evolutionary Biology Department, University of Siena, Via A. Moro 2, 53100 Siena, Italy

Cited by 100 (Based on Google Scholar [2017-06-16])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 Spinsanti G, Panti C, Lazzeri E, et al. Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba) skin biopsies[J]. BMC molecular biology, 2006, 7(1): 32.
↑ Viale D. Cetaceans in the northwestern Mediterranean: their place in the ecosystem[J]. Oceanography and marine biology, 1985, 23: 491-571.

@@ Line 66: / Line 66: @@
 |}
-===Moleculer Type===
+===Molecular Type===
 * mRNA
 ===Evaluation Methods===
 * [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']