Stenella coeruleoalba

From ICG
Jump to navigation Jump to search

Description

Striped Dolphin Skin Biopsies

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
GAPDH[1] glyceraldehyde-3-phosphate dehydrogenase
  • Universal reference genes
DQ404538
  • F:CAAGGCTGTGGGCAAGGTCATC
  • R:TTCTCCAGGCGGCAGGTCAG
111 60 SYBR
YWHAZ[1] tyrosine 3-monooxygenase
  • Universal reference genes
DQ404539
  • F:AAATGAAAGGAGACTACTACCGCTA
  • R:AGACCCAATCTGATAGGATGTGTTG
151 60 SYBR
RPL4[1] ribosomal Protein L4
  • Universal reference genes
DQ404536
  • F:CAGACCTTAGCAGAATCTTGAAAAGC
  • R:CCTGGCGAAGAATGGTGTTCC
171 60 SYBR
RPS18[1] ribosomal Protein S18
  • Universal reference genes
DQ404537
  • F:CAATTAAGGGTGTGGGGCGAAG
  • R:TCTTGTATTGGCGTGGATTCTGC
141 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Giacomo Spinsanti
  • Email: spinsanti@unisi.it
  • Institution: Evolutionary Biology Department, University of Siena, Via A. Moro 2, 53100 Siena, Italy

References

  1. 1.0 1.1 1.2 1.3