Difference between revisions of "Stipa grandis"

From ICG
Jump to navigation Jump to search
 
(16 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:Stipa grandis-1.jpg|right|210px]]
+
[[File:Stipa grandis-1.png|right|200px|link=Stipa grandis]]
*'''''Stipa grandis''''' P. Smirn. is a C3 perennial bunchgrass that is distributed widely in eastern Eurasian steppes and the middle Eurasian steppe zone.<ref name="ref1"/> <ref name="ref2"/>  
+
* '''''Stipa grandis''''' P. Smirn. is a C3 perennial bunchgrass that is distributed widely in eastern Eurasian steppes and the middle Eurasian steppe zone <ref name="ref1"/><ref name="ref2"/>. This species is dominant in the typical steppe of the Xilingole Plateau of Inner Mongolia <ref name="ref1"/>. The ''S. grandis'' steppe acts as a natural green barrier and plays an important role in sandstorm prevention <ref name="ref3"/><ref name="ref4"/>.
*This species is dominant in the typical steppe of the Xilingole Plateau of Inner Mongolia. <ref name="ref1"/>
+
* <font color=blue>'''Common Name:'''</font> '''Unknown'''
*The S. grandis steppe acts as a natural green barrier and plays an important role in sandstorm prevention.<ref name="ref3"/><ref name="ref4"/>
 
* <font color=blue>'''Common Name:'''</font> '''Stipa grandis'''
 
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=408131<font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=408131<font color=blue>'''NCBI Taxonomy'''</font>]
  
===Reference Genes===
+
=='''''Abiotic Stress'''''==
 +
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 136: Line 135:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer types===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 148: Line 149:
 
*'''Institute''': Key Laboratory of Grassland Resources and Utilization of Ministry of Agriculture, Institute of Grassland Research, Chinese Academy of Agricultural Sciences, Hohhot, China
 
*'''Institute''': Key Laboratory of Grassland Resources and Utilization of Ministry of Agriculture, Institute of Grassland Research, Chinese Academy of Agricultural Sciences, Hohhot, China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''??''' (Based on Google Scholar [2017-08-01])
+
Cited by '''0''' (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 170: Line 171:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 +
[[Category:EF1α]][[Category:Ubiquitin]] [[Category:ACT]] [[Category:GAPDH]] [[Category:SKIP]] [[Category:HERC2]] [[Category:CUL4]][[Category:Abiotic Stress]][[Category:Drought Treatment]][[Category:Salinity Treatment]][[Category:Hormone Treatment]][[Category:PH Treatment]][[Category:Heat Treatment]][[Category:Cold Treatment]][[Category:SYBR]]
 +
[[Category:Plants]][[Category:geNorm]][[Category:NormFinder]][[Category:BestKeeper]][[Category:RefFinder]]

Latest revision as of 05:27, 1 September 2017

Description

Stipa grandis-1.png
  • Stipa grandis P. Smirn. is a C3 perennial bunchgrass that is distributed widely in eastern Eurasian steppes and the middle Eurasian steppe zone [1][2]. This species is dominant in the typical steppe of the Xilingole Plateau of Inner Mongolia [1]. The S. grandis steppe acts as a natural green barrier and plays an important role in sandstorm prevention [3][4].
  • Common Name: Unknown
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1beta[4] Elongation factor 1-beta
  • Drought and salt stresses
  • Jasmonic acid treatment
  • All samples
NA
  • F:CCATCAACGAATACGTCCAGAG
  • R:CCCCAGTTCCAAGAATCCACTA
97 60 SYBR
UBC15[4] Ubiquitin-conjugating enzyme 15
  • Drought and salt stresses
  • High pH stress
  • Wounding stress
  • Abscisic acid treatment
NA
  • F:GACCGCTATGTTAGGAACTGCC
  • R:AGAAGAGCCAAACCAATGCC
100 60 SYBR
ACT[4] Actin-7
  • Heat stress
NA
  • F:GCATGAAGGTGAAGGTGGTT
  • R:TCATCGTACTCTGCCTTGGA
121 60 SYBR
GAPDH[4] Glyceraldehyde-3-phosphate dehydrogenase
  • Heat stress
NA
  • F:GGTATGTCCTTCCGTGTTCC
  • R:CGCCTTGATAGCCTTCTTGA
105 60 SYBR
SKIP5[4] ASK-interacting protein
  • Cold stress
NA
  • F:TGTGAGCAAAACCCTCTGGAT
  • R:TTGAGCGATGAGAATGAGTCATACT
80 60 SYBR
UBC17[4] Ubiquitin-conjugating enzyme E2-17
  • Cold stress
  • Jasmonic acid treatment
  • Salicylic acid treatment
NA
  • F:TATCCGTTCAAGCCTCCAAAG
  • R:GGTCGGTAAGTAGTGAGCAGATT
160 60 SYBR
HERC2[4] HECT domain E3 ubiquitin ligases
  • High pH stress
  • Salicylic acid treatment
  • All samples
NA
  • F:ATGGGCTTCGGGAGTTTAGG
  • R:GCTTATTTGGGAGACATAGTGACC
105 60 SYBR
UBC2[4] Ubiquitin-conjugating enzyme E2 2
  • Wounding stress
NA
  • F:AACATCACGGTCTGGAACGC
  • R:GTTGGTGGCTTGTTGGGATAA
113 60 SYBR
CUL4[4] Cullin-4
  • Abscisic acid treatment
NA
  • F:GTGGAAGGCGTCTGATGTGG
  • R:GCTTAGCTTTTGTGCGTCGTT
140 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiangyang Hou
  • Email: Houxy16@126.com
  • Institute: Key Laboratory of Grassland Resources and Utilization of Ministry of Agriculture, Institute of Grassland Research, Chinese Academy of Agricultural Sciences, Hohhot, China

Citation Statistics

Cited by 0 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 Wu JB, Gao YB, Bao XY, Gao H, Jia MQ, Li J, Zhao NX. Genetic variation among Stipa grandis P. Smirn populations with different durations of fencing in the Inner Mongolian Steppe. The Rangeland Journal. 2010 Dec 17;32(4):427-34.
  2. Song X, Wang Y, Lv X. Responses of plant biomass, photosynthesis and lipid peroxidation to warming and precipitation change in two dominant species (Stipa grandis and Leymus chinensis) from North China Grasslands. Ecol Evol. 2016 Feb 20;6(6):1871-82.
  3. Zhao NX, Gao YB, Wang JL, Ren AZ. Population structure and genetic diversity of Stipa grandis P. Smirn, a dominant species in the typical steppe of northern China. Biochemical Systematics and Ecology. 2008 Jan 31;36(1):1-0.
  4. 4.0 4.1 4.2 4.3 4.4 4.5 4.6 4.7 4.8 4.9 Wan D, Wan Y, Yang Q, Zou B, Ren W, Ding Y, Wang Z, Wang R, Wang K, Hou X. Selection of Reference Genes for qRT-PCR Analysis of Gene Expression in Stipa grandis during Environmental Stresses. PLoS One. 2017 Jan 5;12(1):e0169465.

Categories