Difference between revisions of "Streptococcus agalactiae"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
[[File:Streptococcus agalactiae-1.jpg|right|200px|link=Streptococcus agalactiae]]
 
[[File:Streptococcus agalactiae-1.jpg|right|200px|link=Streptococcus agalactiae]]
*'''''Streptococcus agalactiae''''', group B streptococci (GBS), is a leading cause of bacterial sepsis and meningitis in neonates from industrialized countries, and an emerging pathogen in nonpregnant adults.  
+
*'''''Streptococcus agalactiae''''', group B streptococci (GBS), is a leading cause of bacterial sepsis and meningitis in neonates from industrialized countries, and an emerging pathogen in nonpregnant adults. GBS expression studies allowed the identification and characterization of virulence factors and a better understanding of the host pathogen–environment interactions <ref name="ref1"/>.
*GBS expression studies allowed the identification and characterization of virulence factors and a better understanding of the host pathogen–environment interactions. <ref name="ref1"/>
 
 
* <font color=blue>'''Common Name:'''</font> '''Unknown'''
 
* <font color=blue>'''Common Name:'''</font> '''Unknown'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=1311&lvl=3&lin=f&keep=1&srchmode=1&unlock<font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=1311&lvl=3&lin=f&keep=1&srchmode=1&unlock<font color=blue>'''NCBI Taxonomy'''</font>]

Revision as of 06:00, 10 August 2017

Description

Streptococcus agalactiae-1.jpg
  • Streptococcus agalactiae, group B streptococci (GBS), is a leading cause of bacterial sepsis and meningitis in neonates from industrialized countries, and an emerging pathogen in nonpregnant adults. GBS expression studies allowed the identification and characterization of virulence factors and a better understanding of the host pathogen–environment interactions [1].
  • Common Name: Unknown
  • NCBI Taxonomy

Growth Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
recA[1] Recombinase A
  • Different temperature conditions (37 °C and 40 °C)
NA
  • F:ATTCAGGCGCAGTTGATTTAGTT
  • R:TCAATCTCAGCACGAGGAACA
67 60 SYBR
sdhA[1] Serine dehydratase
  • Different temperature conditions (37 °C and 40 °C)
NA
  • F:TGTGAAGCGGAATGCTCTTG
  • R:TGGAATTTGCGATTCAATACCA
82 60 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: J.P. Gomes
  • Email: j.paulo.gomes@insa.min-saude.pt
  • Institute: Department of Infectious Diseases, National Institute of Health, Av. Padre Cruz, 1649–016, Lisbon, Portugal

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. 1.0 1.1 1.2 Florindo C, Ferreira R, Borges V, Spellerberg B, Gomes JP, Borrego MJ. Selection of reference genes for real-time expression studies in Streptococcus agalactiae. J Microbiol Methods. 2012 Sep;90(3):220-7.

Categories